EMAIL THIS PAGE TO A FRIEND

ZNF689

zinc finger protein 689

Synonyms: TIPUH1
UniProtKB ID: Q96CS4, Q658J5
Gene ID:
dog(489910) zinc finger protein 689
cow(539836) zinc finger protein 689
sheep(101123005) zinc finger protein 689
domestic guinea pig(100730403) zinc finger protein 689
naked mole-rat(101697290) zinc finger protein 689
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138447 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138447 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138447 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138447 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363614 predicted 1403
2 SASI_Hs01_00066338 predicted 593
3 SASI_Hs01_00066343 predicted 1437
4 SASI_Hs01_00066345 predicted 599
5 SASI_Hs02_00363615 predicted 1598
6 SASI_Hs02_00363616 predicted 1529
7 SASI_Hs01_00066337 predicted 857
8 SASI_Hs02_00363617 predicted 809
9 SASI_Hs02_00363618 predicted 809
10 SASI_Hs01_00066339 predicted 1343
11 SASI_Hs01_00066340 predicted 1018
12 SASI_Hs01_00066341 predicted 1353
13 SASI_Hs01_00066342 predicted 1017
14 SASI_Hs01_00066344 predicted 779
15 SASI_Hs01_00066346 predicted 780
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138447
VALIDATED
ZNF689 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 689
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138447.1-785s21c1
Sequence:CCGGCTGTACCTTCCCTGATCATCACTCGAGTGATGATCAGGGAAGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138447.1-821s21c1
Sequence:CCGGCAAGTGCGCCCAGAATCTAAACTCGAGTTTAGATTCTGGGCGCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138447.1-956s21c1
Sequence:CCGGACGTTTCTCCCAGCGCAAGAACTCGAGTTCTTGCGCTGGGAGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138447.1-2003s21c1
Sequence:CCGGTTAGGAGAGGTGACGTCATTTCTCGAGAAATGACGTCACCTCTCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138447.1-1763s21c1
Sequence:CCGGCCCAAACTGTAGCCCTAGATCCTCGAGGATCTAGGGCTACAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138447.1-668s1c1
Sequence:CCGGGAAGGAAGTATTCCCGCCTAACTCGAGTTAGGCGGGAATACTTCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_138447.1-1613s1c1
Sequence:CCGGCGACCTTTGCTCCAAGCGTTTCTCGAGAAACGCTTGGAGCAAAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_138447.1-551s1c1
Sequence:CCGGCATCTCCTGGTTGGAACGAAACTCGAGTTTCGTTCCAACCAGGAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138447.1-1412s1c1
Sequence:CCGGGCTCTTGCACACCGGAGAGAACTCGAGTTCTCTCCGGTGTGCAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138447
VALIDATED
ZNF689 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 689
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138447.1-785s21c1
Sequence:CCGGCTGTACCTTCCCTGATCATCACTCGAGTGATGATCAGGGAAGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138447.1-821s21c1
Sequence:CCGGCAAGTGCGCCCAGAATCTAAACTCGAGTTTAGATTCTGGGCGCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138447.1-956s21c1
Sequence:CCGGACGTTTCTCCCAGCGCAAGAACTCGAGTTCTTGCGCTGGGAGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138447.1-2003s21c1
Sequence:CCGGTTAGGAGAGGTGACGTCATTTCTCGAGAAATGACGTCACCTCTCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138447.1-1763s21c1
Sequence:CCGGCCCAAACTGTAGCCCTAGATCCTCGAGGATCTAGGGCTACAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138447.1-668s1c1
Sequence:CCGGGAAGGAAGTATTCCCGCCTAACTCGAGTTAGGCGGGAATACTTCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_138447.1-1613s1c1
Sequence:CCGGCGACCTTTGCTCCAAGCGTTTCTCGAGAAACGCTTGGAGCAAAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_138447.1-551s1c1
Sequence:CCGGCATCTCCTGGTTGGAACGAAACTCGAGTTTCGTTCCAACCAGGAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138447.1-1412s1c1
Sequence:CCGGGCTCTTGCACACCGGAGAGAACTCGAGTTCTCTCCGGTGTGCAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138447
VALIDATED
ZNF689 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 689
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138447.1-785s21c1
Sequence:CCGGCTGTACCTTCCCTGATCATCACTCGAGTGATGATCAGGGAAGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138447.1-821s21c1
Sequence:CCGGCAAGTGCGCCCAGAATCTAAACTCGAGTTTAGATTCTGGGCGCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138447.1-956s21c1
Sequence:CCGGACGTTTCTCCCAGCGCAAGAACTCGAGTTCTTGCGCTGGGAGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138447.1-2003s21c1
Sequence:CCGGTTAGGAGAGGTGACGTCATTTCTCGAGAAATGACGTCACCTCTCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138447.1-1763s21c1
Sequence:CCGGCCCAAACTGTAGCCCTAGATCCTCGAGGATCTAGGGCTACAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138447.1-668s1c1
Sequence:CCGGGAAGGAAGTATTCCCGCCTAACTCGAGTTAGGCGGGAATACTTCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_138447.1-1613s1c1
Sequence:CCGGCGACCTTTGCTCCAAGCGTTTCTCGAGAAACGCTTGGAGCAAAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_138447.1-551s1c1
Sequence:CCGGCATCTCCTGGTTGGAACGAAACTCGAGTTTCGTTCCAACCAGGAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138447.1-1412s1c1
Sequence:CCGGGCTCTTGCACACCGGAGAGAACTCGAGTTCTCTCCGGTGTGCAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks