EMAIL THIS PAGE TO A FRIEND

ZNF691

zinc finger protein 691

Synonyms: Zfp691
UniProtKB ID: Q5VV52, A8MXP6, B4DJR7, O95878, Q9NWE8
Gene ID:
dog(482438) zinc finger protein 691
domestic cat(101100143) zinc finger protein 691
naked mole-rat(101698253) zinc finger protein 691
domestic guinea pig(100725968) zinc finger protein 691
cow(532460) zinc finger protein 691
sheep(101106807) zinc finger protein 691
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015911 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015911 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015911 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU088061 MISSION® esiRNA esiRNA human ZNF691 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015911 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243848 predicted 1255
2 SASI_Hs01_00243849 predicted 1222
3 SASI_Hs01_00243851 predicted 384
4 SASI_Hs02_00348516 predicted 549
5 SASI_Hs01_00243852 predicted 943
6 SASI_Hs02_00348517 predicted 835
7 SASI_Hs01_00243853 predicted 1344
8 SASI_Hs01_00243854 predicted 406
9 SASI_Hs02_00348518 predicted 1259
10 SASI_Hs01_00243855 predicted 956
11 SASI_Hs01_00243847 predicted 719
12 SASI_Hs01_00243850 predicted 300
13 SASI_Hs01_00243856 predicted 1322
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015911
VALIDATED
ZNF691 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 691
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015911.2-1436s1c1
Sequence:CCGGCACCTTAGAAATGAAAGGGAACTCGAGTTCCCTTTCATTTCTAAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015911.2-460s1c1
Sequence:CCGGCCTGGAAGAGAAACACTACAACTCGAGTTGTAGTGTTTCTCTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_015911.2-754s1c1
Sequence:CCGGCTTCAGCGATATCTCCAACTTCTCGAGAAGTTGGAGATATCGCTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015911.2-293s1c1
Sequence:CCGGGCAGATGAGAAGCCCTTTATACTCGAGTATAAAGGGCTTCTCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015911.2-132s21c1
Sequence:CCGGTGGATGACTCAGAGGGTTCTTCTCGAGAAGAACCCTCTGAGTCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015911.2-818s21c1
Sequence:CCGGTGCACTGTGTGTGGGAAACACCTCGAGGTGTTTCCCACACACAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015911.2-1230s21c1
Sequence:CCGGGGCCTTTGAGGAAGTACTTATCTCGAGATAAGTACTTCCTCAAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_015911.2-745s21c1
Sequence:CCGGTGGGCGGACCTTCAGCGATATCTCGAGATATCGCTGAAGGTCCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015911.2-193s21c1
Sequence:CCGGGTCGGATGAACTGCAAGAAACCTCGAGGTTTCTTGCAGTTCATCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015911
VALIDATED
ZNF691 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 691
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015911.2-1436s1c1
Sequence:CCGGCACCTTAGAAATGAAAGGGAACTCGAGTTCCCTTTCATTTCTAAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015911.2-460s1c1
Sequence:CCGGCCTGGAAGAGAAACACTACAACTCGAGTTGTAGTGTTTCTCTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_015911.2-754s1c1
Sequence:CCGGCTTCAGCGATATCTCCAACTTCTCGAGAAGTTGGAGATATCGCTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015911.2-293s1c1
Sequence:CCGGGCAGATGAGAAGCCCTTTATACTCGAGTATAAAGGGCTTCTCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015911.2-132s21c1
Sequence:CCGGTGGATGACTCAGAGGGTTCTTCTCGAGAAGAACCCTCTGAGTCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015911.2-818s21c1
Sequence:CCGGTGCACTGTGTGTGGGAAACACCTCGAGGTGTTTCCCACACACAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015911.2-1230s21c1
Sequence:CCGGGGCCTTTGAGGAAGTACTTATCTCGAGATAAGTACTTCCTCAAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_015911.2-745s21c1
Sequence:CCGGTGGGCGGACCTTCAGCGATATCTCGAGATATCGCTGAAGGTCCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015911.2-193s21c1
Sequence:CCGGGTCGGATGAACTGCAAGAAACCTCGAGGTTTCTTGCAGTTCATCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015911
VALIDATED
ZNF691 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 691
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015911.2-1436s1c1
Sequence:CCGGCACCTTAGAAATGAAAGGGAACTCGAGTTCCCTTTCATTTCTAAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015911.2-460s1c1
Sequence:CCGGCCTGGAAGAGAAACACTACAACTCGAGTTGTAGTGTTTCTCTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_015911.2-754s1c1
Sequence:CCGGCTTCAGCGATATCTCCAACTTCTCGAGAAGTTGGAGATATCGCTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015911.2-293s1c1
Sequence:CCGGGCAGATGAGAAGCCCTTTATACTCGAGTATAAAGGGCTTCTCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015911.2-132s21c1
Sequence:CCGGTGGATGACTCAGAGGGTTCTTCTCGAGAAGAACCCTCTGAGTCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015911.2-818s21c1
Sequence:CCGGTGCACTGTGTGTGGGAAACACCTCGAGGTGTTTCCCACACACAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015911.2-1230s21c1
Sequence:CCGGGGCCTTTGAGGAAGTACTTATCTCGAGATAAGTACTTCCTCAAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_015911.2-745s21c1
Sequence:CCGGTGGGCGGACCTTCAGCGATATCTCGAGATATCGCTGAAGGTCCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015911.2-193s21c1
Sequence:CCGGGTCGGATGAACTGCAAGAAACCTCGAGGTTTCTTGCAGTTCATCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks