EMAIL THIS PAGE TO A FRIEND

ZNF692

zinc finger protein 692

Synonyms: AREBP Zfp692
Gene ID:
cow(507847) zinc finger protein 692
sheep(101112645) zinc finger protein 692
domestic guinea pig(100734961) zinc finger protein 692
naked mole-rat(101723076) zinc finger protein 692
Zebrafish(565874) zinc finger protein 692
chicken(427095) zinc finger protein 692
domestic cat(101081779) zinc finger protein 692
dog(482698) zinc finger protein 692
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017865 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017865 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017865 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149331 MISSION® esiRNA esiRNA human ZNF692 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017865 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017865 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035045 predicted 329
2 SASI_Hs01_00035047 predicted 571
3 SASI_Hs02_00350781 predicted 1680
4 SASI_Hs01_00035048 predicted 1414
5 SASI_Hs01_00035049 predicted 1139
6 SASI_Hs01_00035051 predicted 1222
7 SASI_Hs02_00350782 predicted 537
8 SASI_Hs01_00035053 predicted 1192
9 SASI_Hs01_00035054 predicted 1380
10 SASI_Hs02_00350783 predicted 1481
11 SASI_Hs01_00035046 predicted 1377
12 SASI_Hs01_00035050 predicted 1333
13 SASI_Hs01_00035052 predicted 1354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017865
VALIDATED
ZNF692 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 692
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_017865.2-1788s21c1
Sequence:CCGGGAGAGGGTCTGCTTGAGAAATCTCGAGATTTCTCAAGCAGACCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017865.2-1088s21c1
Sequence:CCGGGGATGAGGACACTGCACAAATCTCGAGATTTGTGCAGTGTCCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017865.2-1420s21c1
Sequence:CCGGAGTGTGAGATATGCGGGTTTACTCGAGTAAACCCGCATATCTCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017865.2-1264s21c1
Sequence:GTACCGGGTGGGAAGTCTTTCAACTTTACTCGAGTAAAGTTGAAAGACTTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017865.2-861s21c1
Sequence:CCGGCCTGTCACCTGCACACCTAAACTCGAGTTTAGGTGTGCAGGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017865.2-1193s1c1
Sequence:CCGGGCAGTATTTGAATCACCACAACTCGAGTTGTGGTGATTCAAATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017865.2-1376s1c1
Sequence:CCGGCCTTGTCATCCACAGACGTATCTCGAGATACGTCTGTGGATGACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017865.2-819s1c1
Sequence:CCGGCCAGATGATAGTGAGCCTGATCTCGAGATCAGGCTCACTATCATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017865.2-1277s1c1
Sequence:CCGGCAACTTTAAGAAACACCTGAACTCGAGTTCAGGTGTTTCTTAAAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017865.2-639s1c1
Sequence:CCGGGCAGATTTGGAATCTGAGCATCTCGAGATGCTCAGATTCCAAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017865
VALIDATED
ZNF692 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 692
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_017865.2-1788s21c1
Sequence:CCGGGAGAGGGTCTGCTTGAGAAATCTCGAGATTTCTCAAGCAGACCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017865.2-1088s21c1
Sequence:CCGGGGATGAGGACACTGCACAAATCTCGAGATTTGTGCAGTGTCCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017865.2-1420s21c1
Sequence:CCGGAGTGTGAGATATGCGGGTTTACTCGAGTAAACCCGCATATCTCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017865.2-1264s21c1
Sequence:GTACCGGGTGGGAAGTCTTTCAACTTTACTCGAGTAAAGTTGAAAGACTTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017865.2-861s21c1
Sequence:CCGGCCTGTCACCTGCACACCTAAACTCGAGTTTAGGTGTGCAGGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017865.2-1193s1c1
Sequence:CCGGGCAGTATTTGAATCACCACAACTCGAGTTGTGGTGATTCAAATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017865.2-1376s1c1
Sequence:CCGGCCTTGTCATCCACAGACGTATCTCGAGATACGTCTGTGGATGACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017865.2-819s1c1
Sequence:CCGGCCAGATGATAGTGAGCCTGATCTCGAGATCAGGCTCACTATCATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017865.2-1277s1c1
Sequence:CCGGCAACTTTAAGAAACACCTGAACTCGAGTTCAGGTGTTTCTTAAAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017865.2-639s1c1
Sequence:CCGGGCAGATTTGGAATCTGAGCATCTCGAGATGCTCAGATTCCAAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017865
VALIDATED
ZNF692 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 692
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_017865.2-1788s21c1
Sequence:CCGGGAGAGGGTCTGCTTGAGAAATCTCGAGATTTCTCAAGCAGACCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017865.2-1088s21c1
Sequence:CCGGGGATGAGGACACTGCACAAATCTCGAGATTTGTGCAGTGTCCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017865.2-1420s21c1
Sequence:CCGGAGTGTGAGATATGCGGGTTTACTCGAGTAAACCCGCATATCTCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017865.2-1264s21c1
Sequence:GTACCGGGTGGGAAGTCTTTCAACTTTACTCGAGTAAAGTTGAAAGACTTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017865.2-861s21c1
Sequence:CCGGCCTGTCACCTGCACACCTAAACTCGAGTTTAGGTGTGCAGGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017865.2-1193s1c1
Sequence:CCGGGCAGTATTTGAATCACCACAACTCGAGTTGTGGTGATTCAAATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017865.2-1376s1c1
Sequence:CCGGCCTTGTCATCCACAGACGTATCTCGAGATACGTCTGTGGATGACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017865.2-819s1c1
Sequence:CCGGCCAGATGATAGTGAGCCTGATCTCGAGATCAGGCTCACTATCATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017865.2-1277s1c1
Sequence:CCGGCAACTTTAAGAAACACCTGAACTCGAGTTCAGGTGTTTCTTAAAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017865.2-639s1c1
Sequence:CCGGGCAGATTTGGAATCTGAGCATCTCGAGATGCTCAGATTCCAAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks