EMAIL THIS PAGE TO A FRIEND

ZNF695

zinc finger protein 695

Synonyms: RP11-551G24.1 SBZF3
Species: Human ZNF695(57116)
UniProtKB ID: Q8IW36, Q5T0N9, Q5T0P1, Q5T0P3, Q7Z2W8, Q7Z648
Gene ID:
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020394 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020394 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020394 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020394 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020394 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353367 predicted 1652
2 SASI_Hs02_00353368 predicted 1048
3 SASI_Hs02_00353369 predicted 1053
4 SASI_Hs02_00353370 predicted 891
5 SASI_Hs02_00353371 predicted 710
6 SASI_Hs02_00353372 predicted 560
7 SASI_Hs02_00353373 predicted 497
8 SASI_Hs02_00353374 predicted 568
9 SASI_Hs02_00353375 predicted 485
10 SASI_Hs02_00353376 predicted 1716
11 SASI_Hs01_00120996 predicted 269
12 SASI_Hs01_00120997 predicted 254
13 SASI_Hs01_00120998 predicted 265
14 SASI_Hs01_00120999 predicted 296
15 SASI_Hs01_00121000 predicted 251
16 SASI_Hs01_00121001 predicted 266
17 SASI_Hs01_00121002 predicted 260
18 SASI_Hs01_00121003 predicted 247
19 SASI_Hs01_00121004 predicted 251
20 SASI_Hs01_00121005 predicted 244
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020394
VALIDATED
ZNF695 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 695
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020394.2-582s1c1
Sequence:CCGGCCAGAAGCAGAAGCATGTAAACTCGAGTTTACATGCTTCTGCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020394.2-489s1c1
Sequence:CCGGCGCTTAAGGAATGACTGGGAACTCGAGTTCCCAGTCATTCCTTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020394.2-278s1c1
Sequence:CCGGCCTATTTCACAGTCTTGCTATCTCGAGATAGCAAGACTGTGAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_020394.2-370s1c1
Sequence:CCGGCCAAACACTCAGCTTTGTCTTCTCGAGAAGACAAAGCTGAGTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020394.2-262s1c1
Sequence:CCGGGCTTCAATATGCAATTCCTATCTCGAGATAGGAATTGCATATTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020394.3-1874s21c1
Sequence:CCGGGGTTCAACACCTCCACTTATACTCGAGTATAAGTGGAGGTGTTGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020394.3-414s21c1
Sequence:CCGGCTTATCTTACTGAAGACATTTCTCGAGAAATGTCTTCAGTAAGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020394.3-807s21c1
Sequence:CCGGTTAATGAGTGCTCATGCTTTACTCGAGTAAAGCATGAGCACTCATTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020394.3-1062s21c1
Sequence:CCGGAGTTGTTCCCATACCTTACTCCTCGAGGAGTAAGGTATGGGAACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020394.3-714s21c1
Sequence:CCGGGCAATGTCTCTTGCATGTCTTCTCGAGAAGACATGCAAGAGACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020394.3-1148s21c1
Sequence:CCGGTTGTTGTCATACCTTACTCAACTCGAGTTGAGTAAGGTATGACAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020394.3-976s21c1
Sequence:CCGGTAACCTGTGCTCAGTTCTTACCTCGAGGTAAGAACTGAGCACAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020394.3-748s21c1
Sequence:CCGGACAGCAGAGAATCCATATTGGCTCGAGCCAATATGGATTCTCTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020394
VALIDATED
ZNF695 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 695
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020394.2-582s1c1
Sequence:CCGGCCAGAAGCAGAAGCATGTAAACTCGAGTTTACATGCTTCTGCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020394.2-489s1c1
Sequence:CCGGCGCTTAAGGAATGACTGGGAACTCGAGTTCCCAGTCATTCCTTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020394.2-278s1c1
Sequence:CCGGCCTATTTCACAGTCTTGCTATCTCGAGATAGCAAGACTGTGAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_020394.2-370s1c1
Sequence:CCGGCCAAACACTCAGCTTTGTCTTCTCGAGAAGACAAAGCTGAGTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020394.2-262s1c1
Sequence:CCGGGCTTCAATATGCAATTCCTATCTCGAGATAGGAATTGCATATTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020394.3-1874s21c1
Sequence:CCGGGGTTCAACACCTCCACTTATACTCGAGTATAAGTGGAGGTGTTGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020394.3-414s21c1
Sequence:CCGGCTTATCTTACTGAAGACATTTCTCGAGAAATGTCTTCAGTAAGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020394.3-807s21c1
Sequence:CCGGTTAATGAGTGCTCATGCTTTACTCGAGTAAAGCATGAGCACTCATTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020394.3-1062s21c1
Sequence:CCGGAGTTGTTCCCATACCTTACTCCTCGAGGAGTAAGGTATGGGAACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020394.3-714s21c1
Sequence:CCGGGCAATGTCTCTTGCATGTCTTCTCGAGAAGACATGCAAGAGACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020394.3-1148s21c1
Sequence:CCGGTTGTTGTCATACCTTACTCAACTCGAGTTGAGTAAGGTATGACAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020394.3-976s21c1
Sequence:CCGGTAACCTGTGCTCAGTTCTTACCTCGAGGTAAGAACTGAGCACAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020394.3-748s21c1
Sequence:CCGGACAGCAGAGAATCCATATTGGCTCGAGCCAATATGGATTCTCTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020394
VALIDATED
ZNF695 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 695
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020394.2-582s1c1
Sequence:CCGGCCAGAAGCAGAAGCATGTAAACTCGAGTTTACATGCTTCTGCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020394.2-489s1c1
Sequence:CCGGCGCTTAAGGAATGACTGGGAACTCGAGTTCCCAGTCATTCCTTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020394.2-278s1c1
Sequence:CCGGCCTATTTCACAGTCTTGCTATCTCGAGATAGCAAGACTGTGAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_020394.2-370s1c1
Sequence:CCGGCCAAACACTCAGCTTTGTCTTCTCGAGAAGACAAAGCTGAGTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020394.2-262s1c1
Sequence:CCGGGCTTCAATATGCAATTCCTATCTCGAGATAGGAATTGCATATTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020394.3-1874s21c1
Sequence:CCGGGGTTCAACACCTCCACTTATACTCGAGTATAAGTGGAGGTGTTGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020394.3-414s21c1
Sequence:CCGGCTTATCTTACTGAAGACATTTCTCGAGAAATGTCTTCAGTAAGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020394.3-807s21c1
Sequence:CCGGTTAATGAGTGCTCATGCTTTACTCGAGTAAAGCATGAGCACTCATTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020394.3-1062s21c1
Sequence:CCGGAGTTGTTCCCATACCTTACTCCTCGAGGAGTAAGGTATGGGAACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020394.3-714s21c1
Sequence:CCGGGCAATGTCTCTTGCATGTCTTCTCGAGAAGACATGCAAGAGACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020394.3-1148s21c1
Sequence:CCGGTTGTTGTCATACCTTACTCAACTCGAGTTGAGTAAGGTATGACAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020394.3-976s21c1
Sequence:CCGGTAACCTGTGCTCAGTTCTTACCTCGAGGTAAGAACTGAGCACAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020394.3-748s21c1
Sequence:CCGGACAGCAGAGAATCCATATTGGCTCGAGCCAATATGGATTCTCTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks