EMAIL THIS PAGE TO A FRIEND

ZNF696

zinc finger protein 696

UniProtKB ID: Q9H7X3, A0AVE2
Gene ID:
dog(100684211) zinc finger protein 696
naked mole-rat(101711726) zinc finger protein 696
sheep(101115041) zinc finger protein 696
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030895 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030895 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030895 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030895 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230391 predicted 414
2 SASI_Hs01_00230392 predicted 948
3 SASI_Hs01_00230393 predicted 1111
4 SASI_Hs01_00230395 predicted 1069
5 SASI_Hs01_00230396 predicted 736
6 SASI_Hs02_00358429 predicted 1370
7 SASI_Hs01_00230397 predicted 416
8 SASI_Hs01_00230398 predicted 1388
9 SASI_Hs01_00230399 predicted 610
10 SASI_Hs01_00230400 predicted 673
11 SASI_Hs01_00230394 predicted 576
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030895
ZNF696 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 696
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030895.2-614s21c1
Sequence:CCGGGGGTCTCTTGGCCTTTGTGAACTCGAGTTCACAAAGGCCAAGAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030895.2-1612s21c1
Sequence:CCGGGTGCGCGGTGAGGAAGTAACACTCGAGTGTTACTTCCTCACCGCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030895.1-1812s1c1
Sequence:CCGGCCGGTGATTGAATCGGTCATTCTCGAGAATGACCGATTCAATCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030895.1-789s1c1
Sequence:CCGGCGCGGCAAAGCACCGGAGCATCTCGAGATGCTCCGGTGCTTTGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030895.1-412s1c1
Sequence:CCGGAGTACCCTGATGGAGTCCCTTCTCGAGAAGGGACTCCATCAGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030895.1-1110s1c1
Sequence:CCGGCCTGCACAGCTCGAACGTGGTCTCGAGACCACGTTCGAGCTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030895.1-678s1c1
Sequence:CCGGCGAGTCAGACGTCCCTCCGAACTCGAGTTCGGAGGGACGTCTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030895
ZNF696 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 696
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030895.2-614s21c1
Sequence:CCGGGGGTCTCTTGGCCTTTGTGAACTCGAGTTCACAAAGGCCAAGAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030895.2-1612s21c1
Sequence:CCGGGTGCGCGGTGAGGAAGTAACACTCGAGTGTTACTTCCTCACCGCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030895.1-1812s1c1
Sequence:CCGGCCGGTGATTGAATCGGTCATTCTCGAGAATGACCGATTCAATCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030895.1-789s1c1
Sequence:CCGGCGCGGCAAAGCACCGGAGCATCTCGAGATGCTCCGGTGCTTTGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030895.1-412s1c1
Sequence:CCGGAGTACCCTGATGGAGTCCCTTCTCGAGAAGGGACTCCATCAGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030895.1-1110s1c1
Sequence:CCGGCCTGCACAGCTCGAACGTGGTCTCGAGACCACGTTCGAGCTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030895.1-678s1c1
Sequence:CCGGCGAGTCAGACGTCCCTCCGAACTCGAGTTCGGAGGGACGTCTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030895
ZNF696 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 696
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030895.2-614s21c1
Sequence:CCGGGGGTCTCTTGGCCTTTGTGAACTCGAGTTCACAAAGGCCAAGAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030895.2-1612s21c1
Sequence:CCGGGTGCGCGGTGAGGAAGTAACACTCGAGTGTTACTTCCTCACCGCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030895.1-1812s1c1
Sequence:CCGGCCGGTGATTGAATCGGTCATTCTCGAGAATGACCGATTCAATCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030895.1-789s1c1
Sequence:CCGGCGCGGCAAAGCACCGGAGCATCTCGAGATGCTCCGGTGCTTTGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030895.1-412s1c1
Sequence:CCGGAGTACCCTGATGGAGTCCCTTCTCGAGAAGGGACTCCATCAGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030895.1-1110s1c1
Sequence:CCGGCCTGCACAGCTCGAACGTGGTCTCGAGACCACGTTCGAGCTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030895.1-678s1c1
Sequence:CCGGCGAGTCAGACGTCCCTCCGAACTCGAGTTCGGAGGGACGTCTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks