EMAIL THIS PAGE TO A FRIEND

ZNF697

zinc finger protein 697

UniProtKB ID: Q5TEC3, Q96IT2
Gene ID:
cow(540379) zinc finger protein 697
sheep(101111062) zinc finger protein 697
naked mole-rat(101709639) zinc finger protein 697
domestic guinea pig(100726523) zinc finger protein 697
domestic cat(101091297) zinc finger protein 697
Horse(100066911) zinc finger protein 697
dog(483147) zinc finger protein 697
175 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080470 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080470 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080470 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025401 MISSION® esiRNA esiRNA human ZNF697 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080470 Rosetta Predictions human pricing
XM_371286 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315146 predicted 2036
2 SASI_Hs02_00315147 predicted 1602
3 SASI_Hs02_00315148 predicted 1919
4 SASI_Hs02_00315149 predicted 1685
5 SASI_Hs02_00315150 predicted 2065
6 SASI_Hs02_00315151 predicted 2076
7 SASI_Hs02_00315152 predicted 1686
8 SASI_Hs02_00315153 predicted 1685
9 SASI_Hs02_00315154 predicted 2214
10 SASI_Hs02_00315155 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00254876 predicted 1866
2 SASI_Hs01_00254877 predicted 1953
3 SASI_Hs01_00254878 predicted 2273
4 SASI_Hs01_00254879 predicted 2043
5 SASI_Hs01_00254880 predicted 2043
6 SASI_Hs01_00254881 predicted 2040
7 SASI_Hs01_00254882 predicted 2273
8 SASI_Hs01_00254883 predicted 1953
9 SASI_Hs01_00254884 predicted 2244
10 SASI_Hs01_00254885 predicted 1806
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080470
ZNF697 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 697
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080470.1-220s21c1
Sequence:CCGGGAAAGAGAAATGGGCTCTAATCTCGAGATTAGAGCCCATTTCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080470.1-353s21c1
Sequence:CCGGGTGAGGAAGAAGGCGTTTCTGCTCGAGCAGAAACGCCTTCTTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080470.1-431s21c1
Sequence:CCGGTGTCTGAGTCTGACAGCATATCTCGAGATATGCTGTCAGACTCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080470.1-4401s21c1
Sequence:GTACCGGCTGCATTAAGTGAGGTTAAATCTCGAGATTTAACCTCACTTAATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080470.1-402s21c1
Sequence:CCGGTGTAGCTGACATGGCGATGTTCTCGAGAACATCGCCATGTCAGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080470
ZNF697 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 697
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080470.1-220s21c1
Sequence:CCGGGAAAGAGAAATGGGCTCTAATCTCGAGATTAGAGCCCATTTCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080470.1-353s21c1
Sequence:CCGGGTGAGGAAGAAGGCGTTTCTGCTCGAGCAGAAACGCCTTCTTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080470.1-431s21c1
Sequence:CCGGTGTCTGAGTCTGACAGCATATCTCGAGATATGCTGTCAGACTCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080470.1-4401s21c1
Sequence:GTACCGGCTGCATTAAGTGAGGTTAAATCTCGAGATTTAACCTCACTTAATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080470.1-402s21c1
Sequence:CCGGTGTAGCTGACATGGCGATGTTCTCGAGAACATCGCCATGTCAGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080470
ZNF697 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 697
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080470.1-220s21c1
Sequence:CCGGGAAAGAGAAATGGGCTCTAATCTCGAGATTAGAGCCCATTTCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080470.1-353s21c1
Sequence:CCGGGTGAGGAAGAAGGCGTTTCTGCTCGAGCAGAAACGCCTTCTTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080470.1-431s21c1
Sequence:CCGGTGTCTGAGTCTGACAGCATATCTCGAGATATGCTGTCAGACTCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080470.1-4401s21c1
Sequence:GTACCGGCTGCATTAAGTGAGGTTAAATCTCGAGATTTAACCTCACTTAATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080470.1-402s21c1
Sequence:CCGGTGTAGCTGACATGGCGATGTTCTCGAGAACATCGCCATGTCAGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks