EMAIL THIS PAGE TO A FRIEND

ZNF699

zinc finger protein 699

Synonyms: hang
UniProtKB ID: Q32M78, Q8N9A1
Gene ID:
domestic cat(101086119) zinc finger protein 699
dog(484970) zinc finger protein 699
domestic guinea pig(100721646) zinc finger protein 699
naked mole-rat(101716930) zinc finger protein 699
cow(530004) zinc finger protein 699
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198535 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198535 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198535 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040641 MISSION® esiRNA esiRNA human ZNF699 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198535 Rosetta Predictions human pricing
XM_371132 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372127 predicted 449
2 SASI_Hs02_00372128 predicted 1476
3 SASI_Hs02_00372129 predicted 323
4 SASI_Hs02_00372130 predicted 421
5 SASI_Hs02_00372131 predicted 450
6 SASI_Hs02_00372132 predicted 1125
7 SASI_Hs02_00372133 predicted 1550
8 SASI_Hs02_00372134 predicted 476
9 SASI_Hs02_00372135 predicted 781
10 SASI_Hs02_00372136 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371132 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00256020 predicted 823
2 SASI_Hs01_00256021 predicted 1845
3 SASI_Hs01_00256022 predicted 694
4 SASI_Hs01_00256023 predicted 791
5 SASI_Hs01_00256024 predicted 826
6 SASI_Hs01_00256025 predicted 1910
7 SASI_Hs01_00256026 predicted 1501
8 SASI_Hs01_00256027 predicted 1917
9 SASI_Hs01_00256028 predicted 850
10 SASI_Hs01_00256029 predicted 1150
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198535
ZNF699 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 699
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198535.1-1033s21c2
Sequence:CCGGAGCTCTTCCTCTCACCTTATACTCGAGTATAAGGTGAGAGGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198535.1-317s21c2
Sequence:CCGGCAGTTGCTTCACAAGATATTTCTCGAGAAATATCTTGTGAAGCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198535.1-44s21c2
Sequence:CCGGTACAGGACTCAGTAGTCTTTGCTCGAGCAAAGACTACTGAGTCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198535.1-249s21c2
Sequence:GTACCGGACTTATCCAGGGCATCTTTATCTCGAGATAAAGATGCCCTGGATAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198535.1-1209s21c2
Sequence:CCGGCTCCTCCTTAAGTATCCATATCTCGAGATATGGATACTTAAGGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198535
ZNF699 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 699
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198535.1-1033s21c2
Sequence:CCGGAGCTCTTCCTCTCACCTTATACTCGAGTATAAGGTGAGAGGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198535.1-317s21c2
Sequence:CCGGCAGTTGCTTCACAAGATATTTCTCGAGAAATATCTTGTGAAGCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198535.1-44s21c2
Sequence:CCGGTACAGGACTCAGTAGTCTTTGCTCGAGCAAAGACTACTGAGTCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198535.1-249s21c2
Sequence:GTACCGGACTTATCCAGGGCATCTTTATCTCGAGATAAAGATGCCCTGGATAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198535.1-1209s21c2
Sequence:CCGGCTCCTCCTTAAGTATCCATATCTCGAGATATGGATACTTAAGGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198535
ZNF699 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 699
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198535.1-1033s21c2
Sequence:CCGGAGCTCTTCCTCTCACCTTATACTCGAGTATAAGGTGAGAGGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198535.1-317s21c2
Sequence:CCGGCAGTTGCTTCACAAGATATTTCTCGAGAAATATCTTGTGAAGCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198535.1-44s21c2
Sequence:CCGGTACAGGACTCAGTAGTCTTTGCTCGAGCAAAGACTACTGAGTCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198535.1-249s21c2
Sequence:GTACCGGACTTATCCAGGGCATCTTTATCTCGAGATAAAGATGCCCTGGATAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198535.1-1209s21c2
Sequence:CCGGCTCCTCCTTAAGTATCCATATCTCGAGATATGGATACTTAAGGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks