EMAIL THIS PAGE TO A FRIEND

ZNF69

zinc finger protein 69

Synonyms: Cos5
Species: Human ZNF69(7620)
UniProtKB ID: Q9UC07, Q86VA7
Gene ID:
6 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021915 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021915 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021915 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021915 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139799 predicted 122
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021915
ZNF69 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 69
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021915.1-183s1c1
Sequence:CCGGGATGCTGGAAACTTTCAGGAACTCGAGTTCCTGAAAGTTTCCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021915.1-165s1c1
Sequence:CCGGGAAACTCTACAAGGAAGTGATCTCGAGATCACTTCCTTGTAGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021915.1-484s1c1
Sequence:CCGGGCCTATGAGTATCAGGAATATCTCGAGATATTCCTGATACTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021915.1-267s1c1
Sequence:CCGGGAGAAACTTCAGGAGTCTCATCTCGAGATGAGACTCCTGAAGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021915.1-492s1c1
Sequence:CCGGGTATCAGGAATATGGACCGAACTCGAGTTCGGTCCATATTCCTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021915
ZNF69 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 69
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021915.1-183s1c1
Sequence:CCGGGATGCTGGAAACTTTCAGGAACTCGAGTTCCTGAAAGTTTCCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021915.1-165s1c1
Sequence:CCGGGAAACTCTACAAGGAAGTGATCTCGAGATCACTTCCTTGTAGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021915.1-484s1c1
Sequence:CCGGGCCTATGAGTATCAGGAATATCTCGAGATATTCCTGATACTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021915.1-267s1c1
Sequence:CCGGGAGAAACTTCAGGAGTCTCATCTCGAGATGAGACTCCTGAAGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021915.1-492s1c1
Sequence:CCGGGTATCAGGAATATGGACCGAACTCGAGTTCGGTCCATATTCCTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021915
ZNF69 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 69
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021915.1-183s1c1
Sequence:CCGGGATGCTGGAAACTTTCAGGAACTCGAGTTCCTGAAAGTTTCCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021915.1-165s1c1
Sequence:CCGGGAAACTCTACAAGGAAGTGATCTCGAGATCACTTCCTTGTAGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021915.1-484s1c1
Sequence:CCGGGCCTATGAGTATCAGGAATATCTCGAGATATTCCTGATACTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021915.1-267s1c1
Sequence:CCGGGAGAAACTTCAGGAGTCTCATCTCGAGATGAGACTCCTGAAGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021915.1-492s1c1
Sequence:CCGGGTATCAGGAATATGGACCGAACTCGAGTTCGGTCCATATTCCTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks