EMAIL THIS PAGE TO A FRIEND

ZNF700

zinc finger protein 700

Species: Human ZNF700(90592)
UniProtKB ID: Q9H0M5, B9EGU4
Gene ID:
13 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV50781 Anti-ZNF700 antibody produced in rabbit affinity isolated antibody human, horse, rabbit, mouse, guinea pig, zebrafish, bovine, canine, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144566 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144566 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144566 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144566 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144566 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230038 predicted 2188
2 SASI_Hs01_00230039 predicted 1648
3 SASI_Hs01_00230040 predicted 1759
4 SASI_Hs01_00230041 predicted 2085
5 SASI_Hs01_00230042 predicted 2021
6 SASI_Hs01_00230043 predicted 809
7 SASI_Hs01_00230044 predicted 2188
8 SASI_Hs01_00230045 predicted 1642
9 SASI_Hs01_00230046 predicted 1756
10 SASI_Hs01_00230047 predicted 1572
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144566
ZNF700 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 700
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144566.1-1763s1c1
Sequence:CCGGGATGTTGCAATTCCCTTCGATCTCGAGATCGAAGGGAATTGCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144566.1-327s1c1
Sequence:CCGGGAGTGACCAGAACATTGAATACTCGAGTATTCAATGTTCTGGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146416    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144566.1-2617s1c1
Sequence:CCGGCTGGAGTGAAACCCTATGAATCTCGAGATTCATAGGGTTTCACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144566.1-2701s1c1
Sequence:CCGGCTTGGGAGAAACTCTATGAATCTCGAGATTCATAGAGTTTCTCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144566.1-1066s1c1
Sequence:CCGGGCATTTGCATATACCAGTTCTCTCGAGAGAACTGGTATATGCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144566.1-2575s1c1
Sequence:CCGGGAGTGTATTCTAGTTCCGTTTCTCGAGAAACGGAACTAGAATACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144566.1-2323s1c1
Sequence:CCGGGAATGTAAGGATTGTGGGAAACTCGAGTTTCCCACAATCCTTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144566.1-1549s1c1
Sequence:CCGGGAATGTAAGGAATGTGGGAAACTCGAGTTTCCCACATTCCTTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144566.1-1684s1c1
Sequence:CCGGGCCAAGTCATTTCAAACACATCTCGAGATGTGTTTGAAATGACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144566
ZNF700 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 700
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144566.1-1763s1c1
Sequence:CCGGGATGTTGCAATTCCCTTCGATCTCGAGATCGAAGGGAATTGCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144566.1-327s1c1
Sequence:CCGGGAGTGACCAGAACATTGAATACTCGAGTATTCAATGTTCTGGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146416    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144566.1-2617s1c1
Sequence:CCGGCTGGAGTGAAACCCTATGAATCTCGAGATTCATAGGGTTTCACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144566.1-2701s1c1
Sequence:CCGGCTTGGGAGAAACTCTATGAATCTCGAGATTCATAGAGTTTCTCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144566.1-1066s1c1
Sequence:CCGGGCATTTGCATATACCAGTTCTCTCGAGAGAACTGGTATATGCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144566.1-2575s1c1
Sequence:CCGGGAGTGTATTCTAGTTCCGTTTCTCGAGAAACGGAACTAGAATACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144566.1-2323s1c1
Sequence:CCGGGAATGTAAGGATTGTGGGAAACTCGAGTTTCCCACAATCCTTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144566.1-1549s1c1
Sequence:CCGGGAATGTAAGGAATGTGGGAAACTCGAGTTTCCCACATTCCTTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144566.1-1684s1c1
Sequence:CCGGGCCAAGTCATTTCAAACACATCTCGAGATGTGTTTGAAATGACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144566
ZNF700 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 700
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144566.1-1763s1c1
Sequence:CCGGGATGTTGCAATTCCCTTCGATCTCGAGATCGAAGGGAATTGCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144566.1-327s1c1
Sequence:CCGGGAGTGACCAGAACATTGAATACTCGAGTATTCAATGTTCTGGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146416    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144566.1-2617s1c1
Sequence:CCGGCTGGAGTGAAACCCTATGAATCTCGAGATTCATAGGGTTTCACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144566.1-2701s1c1
Sequence:CCGGCTTGGGAGAAACTCTATGAATCTCGAGATTCATAGAGTTTCTCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144566.1-1066s1c1
Sequence:CCGGGCATTTGCATATACCAGTTCTCTCGAGAGAACTGGTATATGCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144566.1-2575s1c1
Sequence:CCGGGAGTGTATTCTAGTTCCGTTTCTCGAGAAACGGAACTAGAATACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144566.1-2323s1c1
Sequence:CCGGGAATGTAAGGATTGTGGGAAACTCGAGTTTCCCACAATCCTTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144566.1-1549s1c1
Sequence:CCGGGAATGTAAGGAATGTGGGAAACTCGAGTTTCCCACATTCCTTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144566.1-1684s1c1
Sequence:CCGGGCCAAGTCATTTCAAACACATCTCGAGATGTGTTTGAAATGACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks