EMAIL THIS PAGE TO A FRIEND

ZNF701

zinc finger protein 701

Species: Human ZNF701(55762)
UniProtKB ID: Q9NV72, A2RRM8, Q66K42
Gene ID:
14 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018260 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018260 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018260 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU114981 MISSION® esiRNA esiRNA human ZNF701 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018260 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045095 predicted 1501
2 SASI_Hs01_00045096 predicted 957
3 SASI_Hs01_00045097 predicted 290
4 SASI_Hs02_00351623 predicted 622
5 SASI_Hs01_00045094 predicted 879
6 SASI_Hs01_00045098 predicted 354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018260
ZNF701 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 701
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018260.1-743s1c1
Sequence:CCGGCGGGAAGTACACACAAGAGAACTCGAGTTCTCTTGTGTGTACTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018260.1-871s1c1
Sequence:CCGGCGGCAAGGACTTTCATCAGAACTCGAGTTCTGATGAAAGTCCTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018260.1-979s1c1
Sequence:CCGGCCTGTTAGTTCACAAGGCAATCTCGAGATTGCCTTGTGAACTAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018260.1-363s1c1
Sequence:CCGGGTCATCACATTGGAGATACTTCTCGAGAAGTATCTCCAATGTGATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018260.1-622s1c1
Sequence:CCGGGAAGGCCATCAACGATGCTTTCTCGAGAAAGCATCGTTGATGGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018260.1-1708s21c1
Sequence:CCGGCAAGGATTTCGGGTGTGATTCCTCGAGGAATCACACCCGAAATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018260.1-957s21c1
Sequence:CCGGAGACATTCAGTCACAATTCAGCTCGAGCTGAATTGTGACTGAATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018260.1-486s21c1
Sequence:CCGGTGAGTAGTACAGAGCGACATGCTCGAGCATGTCGCTCTGTACTACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018260.1-1987s21c1
Sequence:CCGGGCAGTTCATTGGCGATCTTATCTCGAGATAAGATCGCCAATGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018260
ZNF701 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 701
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018260.1-743s1c1
Sequence:CCGGCGGGAAGTACACACAAGAGAACTCGAGTTCTCTTGTGTGTACTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018260.1-871s1c1
Sequence:CCGGCGGCAAGGACTTTCATCAGAACTCGAGTTCTGATGAAAGTCCTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018260.1-979s1c1
Sequence:CCGGCCTGTTAGTTCACAAGGCAATCTCGAGATTGCCTTGTGAACTAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018260.1-363s1c1
Sequence:CCGGGTCATCACATTGGAGATACTTCTCGAGAAGTATCTCCAATGTGATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018260.1-622s1c1
Sequence:CCGGGAAGGCCATCAACGATGCTTTCTCGAGAAAGCATCGTTGATGGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018260.1-1708s21c1
Sequence:CCGGCAAGGATTTCGGGTGTGATTCCTCGAGGAATCACACCCGAAATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018260.1-957s21c1
Sequence:CCGGAGACATTCAGTCACAATTCAGCTCGAGCTGAATTGTGACTGAATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018260.1-486s21c1
Sequence:CCGGTGAGTAGTACAGAGCGACATGCTCGAGCATGTCGCTCTGTACTACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018260.1-1987s21c1
Sequence:CCGGGCAGTTCATTGGCGATCTTATCTCGAGATAAGATCGCCAATGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018260
ZNF701 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 701
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018260.1-743s1c1
Sequence:CCGGCGGGAAGTACACACAAGAGAACTCGAGTTCTCTTGTGTGTACTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018260.1-871s1c1
Sequence:CCGGCGGCAAGGACTTTCATCAGAACTCGAGTTCTGATGAAAGTCCTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018260.1-979s1c1
Sequence:CCGGCCTGTTAGTTCACAAGGCAATCTCGAGATTGCCTTGTGAACTAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018260.1-363s1c1
Sequence:CCGGGTCATCACATTGGAGATACTTCTCGAGAAGTATCTCCAATGTGATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018260.1-622s1c1
Sequence:CCGGGAAGGCCATCAACGATGCTTTCTCGAGAAAGCATCGTTGATGGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018260.1-1708s21c1
Sequence:CCGGCAAGGATTTCGGGTGTGATTCCTCGAGGAATCACACCCGAAATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018260.1-957s21c1
Sequence:CCGGAGACATTCAGTCACAATTCAGCTCGAGCTGAATTGTGACTGAATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018260.1-486s21c1
Sequence:CCGGTGAGTAGTACAGAGCGACATGCTCGAGCATGTCGCTCTGTACTACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018260.1-1987s21c1
Sequence:CCGGGCAGTTCATTGGCGATCTTATCTCGAGATAAGATCGCCAATGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks