EMAIL THIS PAGE TO A FRIEND

ZNF702P

zinc finger protein 702, pseudogene

Synonyms: ZNF702
Species: Human ZNF702P(79986)
UniProtKB ID: Q9H963, Q05BW1
Gene ID:
13 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024924 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024924 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024924 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024924 Rosetta Predictions human pricing
NR_003578 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035455 predicted 1090
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003578 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379620 predicted 712
2 SASI_Hs02_00379621 predicted 2175
3 SASI_Hs02_00379622 predicted 1671
4 SASI_Hs02_00379623 predicted 1828
5 SASI_Hs02_00379624 predicted 703
6 SASI_Hs02_00379625 predicted 738
7 SASI_Hs02_00379626 predicted 1866
8 SASI_Hs02_00379627 predicted 2020
9 SASI_Hs02_00379628 predicted 2399
10 SASI_Hs02_00379629 predicted 2326
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024924
ZNF702P MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 702, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024924.3-1225s1c1
Sequence:CCGGGTGAAGAATGTGACAAAGTTTCTCGAGAAACTTTGTCACATTCTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024924.3-908s1c1
Sequence:CCGGCTTTAATTGTAGCTCACTGTTCTCGAGAACAGTGAGCTACAATTAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024924.3-1110s1c1
Sequence:CCGGGCAATTCATACTGGAGAGAAACTCGAGTTTCTCTCCAGTATGAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024924.3-1182s1c1
Sequence:CCGGGCAAGTCATCATAGACTTCATCTCGAGATGAAGTCTATGATGACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024924.3-1093s1c1
Sequence:CCGGCCCTTGTAATTCACAAGGCAACTCGAGTTGCCTTGTGAATTACAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024924
ZNF702P MISSION shRNA shRNA Plasmid DNA
zinc finger protein 702, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024924.3-1225s1c1
Sequence:CCGGGTGAAGAATGTGACAAAGTTTCTCGAGAAACTTTGTCACATTCTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024924.3-908s1c1
Sequence:CCGGCTTTAATTGTAGCTCACTGTTCTCGAGAACAGTGAGCTACAATTAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024924.3-1110s1c1
Sequence:CCGGGCAATTCATACTGGAGAGAAACTCGAGTTTCTCTCCAGTATGAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024924.3-1182s1c1
Sequence:CCGGGCAAGTCATCATAGACTTCATCTCGAGATGAAGTCTATGATGACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024924.3-1093s1c1
Sequence:CCGGCCCTTGTAATTCACAAGGCAACTCGAGTTGCCTTGTGAATTACAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024924
ZNF702P MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 702, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024924.3-1225s1c1
Sequence:CCGGGTGAAGAATGTGACAAAGTTTCTCGAGAAACTTTGTCACATTCTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024924.3-908s1c1
Sequence:CCGGCTTTAATTGTAGCTCACTGTTCTCGAGAACAGTGAGCTACAATTAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024924.3-1110s1c1
Sequence:CCGGGCAATTCATACTGGAGAGAAACTCGAGTTTCTCTCCAGTATGAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024924.3-1182s1c1
Sequence:CCGGGCAAGTCATCATAGACTTCATCTCGAGATGAAGTCTATGATGACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024924.3-1093s1c1
Sequence:CCGGCCCTTGTAATTCACAAGGCAACTCGAGTTGCCTTGTGAATTACAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks