EMAIL THIS PAGE TO A FRIEND

ZNF703

zinc finger protein 703

Synonyms: ZEPPO1 ZNF503L ZPO1
UniProtKB ID: Q9H7S9, Q5XG76
Gene ID:
Zebrafish(114429) zinc finger protein 703
chicken(770560) zinc finger protein 703
domestic cat(101100205) zinc finger protein 703
dog(482855) zinc finger protein 703
cow(782419) zinc finger protein 703
naked mole-rat(101715267) zinc finger protein 703
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025069 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025069 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025069 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025069 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025069 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043290 predicted 1117
2 SASI_Hs01_00043291 predicted 1078
3 SASI_Hs01_00043292 predicted 1164
4 SASI_Hs01_00043293 predicted 1298
5 SASI_Hs01_00043294 predicted 1166
6 SASI_Hs01_00043295 predicted 1213
7 SASI_Hs01_00043296 predicted 1076
8 SASI_Hs01_00043297 predicted 1094
9 SASI_Hs01_00043298 predicted 475
10 SASI_Hs01_00043299 predicted 472
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025069
ZNF703 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 703
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025069.1-1838s21c1
Sequence:CCGGCTATGGCAAGAGCCACTTATCCTCGAGGATAAGTGGCTCTTGCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025069.1-1908s21c1
Sequence:CCGGTATTCGCCATACGCGCTGTATCTCGAGATACAGCGCGTATGGCGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025069.1-1953s21c1
Sequence:CCGGGCGCTGGGATACCAGTAACTACTCGAGTAGTTACTGGTATCCCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025069.1-434s21c1
Sequence:CCGGCATTGAGCTGGACGCCAAGAACTCGAGTTCTTGGCGTCCAGCTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025069.1-1303s21c1
Sequence:CCGGCCTCCTTCCTGCAGGGATTATCTCGAGATAATCCCTGCAGGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025069
ZNF703 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 703
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025069.1-1838s21c1
Sequence:CCGGCTATGGCAAGAGCCACTTATCCTCGAGGATAAGTGGCTCTTGCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025069.1-1908s21c1
Sequence:CCGGTATTCGCCATACGCGCTGTATCTCGAGATACAGCGCGTATGGCGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025069.1-1953s21c1
Sequence:CCGGGCGCTGGGATACCAGTAACTACTCGAGTAGTTACTGGTATCCCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025069.1-434s21c1
Sequence:CCGGCATTGAGCTGGACGCCAAGAACTCGAGTTCTTGGCGTCCAGCTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025069.1-1303s21c1
Sequence:CCGGCCTCCTTCCTGCAGGGATTATCTCGAGATAATCCCTGCAGGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025069
ZNF703 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 703
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025069.1-1838s21c1
Sequence:CCGGCTATGGCAAGAGCCACTTATCCTCGAGGATAAGTGGCTCTTGCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025069.1-1908s21c1
Sequence:CCGGTATTCGCCATACGCGCTGTATCTCGAGATACAGCGCGTATGGCGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025069.1-1953s21c1
Sequence:CCGGGCGCTGGGATACCAGTAACTACTCGAGTAGTTACTGGTATCCCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025069.1-434s21c1
Sequence:CCGGCATTGAGCTGGACGCCAAGAACTCGAGTTCTTGGCGTCCAGCTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025069.1-1303s21c1
Sequence:CCGGCCTCCTTCCTGCAGGGATTATCTCGAGATAATCCCTGCAGGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks