EMAIL THIS PAGE TO A FRIEND

ZNF704

zinc finger protein 704

Synonyms: Gig1
UniProtKB ID: Q6ZNC4, B2RNE6, B9EGW6
Gene ID:
naked mole-rat(101709099) zinc finger protein 704
domestic guinea pig(100724723) zinc finger protein 704
cow(513243) zinc finger protein 704
sheep(101112576) zinc finger protein 704
Zebrafish(560056) zinc finger protein 704
dog(610881) zinc finger protein 704
Horse(100057981) zinc finger protein 704
domestic cat(101091846) zinc finger protein 704
chicken(420194) zinc finger protein 704
156 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033723 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001033723 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001033723 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU096101 MISSION® esiRNA esiRNA human ZNF704 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033723 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201327 predicted 483
2 SASI_Hs01_00201328 predicted 504
3 SASI_Hs01_00201329 predicted 683
4 SASI_Hs01_00201330 predicted 513
5 SASI_Hs01_00201331 predicted 483
6 SASI_Hs01_00201332 predicted 500
7 SASI_Hs02_00308087 predicted 1943
8 SASI_Hs01_00201334 predicted 1295
9 SASI_Hs01_00201335 predicted 1391
10 SASI_Hs01_00201336 predicted 1208
11 SASI_Hs01_00201333 predicted 859
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033723
ZNF704 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 704
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033723.1-852s1c1
Sequence:CCGGCAGCAGGTATCCAGAAACACACTCGAGTGTGTTTCTGGATACCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033723.1-1084s1c1
Sequence:CCGGGACTAAGTTGATGACGCCGTTCTCGAGAACGGCGTCATCAACTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033723.1-1056s1c1
Sequence:CCGGGAACAGAAACTCCTTGTGCCACTCGAGTGGCACAAGGAGTTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033723.1-1215s1c1
Sequence:CCGGGCTTCAGCATTTCCTGGCAATCTCGAGATTGCCAGGAAATGCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159103    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033723.1-1829s1c1
Sequence:CCGGGCTTTCTGAATTATGCCATTTCTCGAGAAATGGCATAATTCAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033723.1-2357s1c1
Sequence:CCGGCGGAGCTATTTGTTACTGCTTCTCGAGAAGCAGTAACAAATAGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161380    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033723.1-3895s1c1
Sequence:CCGGGCACAGGTATAAGCAGAACTACTCGAGTAGTTCTGCTTATACCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033723.1-495s1c1
Sequence:CCGGCAATGGTACTAACCAGCTTGTCTCGAGACAAGCTGGTTAGTACCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033723.1-311s1c1
Sequence:CCGGGCCATGGAGGAAGATGTGAAACTCGAGTTTCACATCTTCCTCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033723
ZNF704 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 704
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033723.1-852s1c1
Sequence:CCGGCAGCAGGTATCCAGAAACACACTCGAGTGTGTTTCTGGATACCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033723.1-1084s1c1
Sequence:CCGGGACTAAGTTGATGACGCCGTTCTCGAGAACGGCGTCATCAACTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033723.1-1056s1c1
Sequence:CCGGGAACAGAAACTCCTTGTGCCACTCGAGTGGCACAAGGAGTTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033723.1-1215s1c1
Sequence:CCGGGCTTCAGCATTTCCTGGCAATCTCGAGATTGCCAGGAAATGCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159103    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033723.1-1829s1c1
Sequence:CCGGGCTTTCTGAATTATGCCATTTCTCGAGAAATGGCATAATTCAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033723.1-2357s1c1
Sequence:CCGGCGGAGCTATTTGTTACTGCTTCTCGAGAAGCAGTAACAAATAGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161380    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033723.1-3895s1c1
Sequence:CCGGGCACAGGTATAAGCAGAACTACTCGAGTAGTTCTGCTTATACCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033723.1-495s1c1
Sequence:CCGGCAATGGTACTAACCAGCTTGTCTCGAGACAAGCTGGTTAGTACCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033723.1-311s1c1
Sequence:CCGGGCCATGGAGGAAGATGTGAAACTCGAGTTTCACATCTTCCTCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033723
ZNF704 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 704
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033723.1-852s1c1
Sequence:CCGGCAGCAGGTATCCAGAAACACACTCGAGTGTGTTTCTGGATACCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033723.1-1084s1c1
Sequence:CCGGGACTAAGTTGATGACGCCGTTCTCGAGAACGGCGTCATCAACTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033723.1-1056s1c1
Sequence:CCGGGAACAGAAACTCCTTGTGCCACTCGAGTGGCACAAGGAGTTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033723.1-1215s1c1
Sequence:CCGGGCTTCAGCATTTCCTGGCAATCTCGAGATTGCCAGGAAATGCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159103    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033723.1-1829s1c1
Sequence:CCGGGCTTTCTGAATTATGCCATTTCTCGAGAAATGGCATAATTCAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033723.1-2357s1c1
Sequence:CCGGCGGAGCTATTTGTTACTGCTTCTCGAGAAGCAGTAACAAATAGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161380    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033723.1-3895s1c1
Sequence:CCGGGCACAGGTATAAGCAGAACTACTCGAGTAGTTCTGCTTATACCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033723.1-495s1c1
Sequence:CCGGCAATGGTACTAACCAGCTTGTCTCGAGACAAGCTGGTTAGTACCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033723.1-311s1c1
Sequence:CCGGGCCATGGAGGAAGATGTGAAACTCGAGTTTCACATCTTCCTCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks