EMAIL THIS PAGE TO A FRIEND

ZNF705A

zinc finger protein 705A

UniProtKB ID: Q6ZN79
Gene ID:
dog(482938) zinc finger protein 705A
cow(100125413) zinc finger protein 705A
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004328 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004328 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004328 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004328 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218781 predicted 1039
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004328
ZNF705A MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 705A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004328.1-554s1c1
Sequence:CCGGCGCATCCACCAGTATGACAATCTCGAGATTGTCATACTGGTGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004328.1-294s1c1
Sequence:CCGGGCTATTGACTTCACCCAGGAACTCGAGTTCCTGGGTGAAGTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004328.1-401s1c1
Sequence:CCGGCCAGATAAGCAAATCCTATATCTCGAGATATAGGATTTGCTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004328.1-631s1c1
Sequence:CCGGGCACTCACAGTTCCACAATAACTCGAGTTATTGTGGAACTGTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004328.1-3165s1c1
Sequence:CCGGCCGTGGTTGAAGTTGACAAATCTCGAGATTTGTCAACTTCAACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004328
ZNF705A MISSION shRNA shRNA Plasmid DNA
zinc finger protein 705A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004328.1-554s1c1
Sequence:CCGGCGCATCCACCAGTATGACAATCTCGAGATTGTCATACTGGTGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004328.1-294s1c1
Sequence:CCGGGCTATTGACTTCACCCAGGAACTCGAGTTCCTGGGTGAAGTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004328.1-401s1c1
Sequence:CCGGCCAGATAAGCAAATCCTATATCTCGAGATATAGGATTTGCTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004328.1-631s1c1
Sequence:CCGGGCACTCACAGTTCCACAATAACTCGAGTTATTGTGGAACTGTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004328.1-3165s1c1
Sequence:CCGGCCGTGGTTGAAGTTGACAAATCTCGAGATTTGTCAACTTCAACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004328
ZNF705A MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 705A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004328.1-554s1c1
Sequence:CCGGCGCATCCACCAGTATGACAATCTCGAGATTGTCATACTGGTGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004328.1-294s1c1
Sequence:CCGGGCTATTGACTTCACCCAGGAACTCGAGTTCCTGGGTGAAGTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004328.1-401s1c1
Sequence:CCGGCCAGATAAGCAAATCCTATATCTCGAGATATAGGATTTGCTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004328.1-631s1c1
Sequence:CCGGGCACTCACAGTTCCACAATAACTCGAGTTATTGTGGAACTGTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004328.1-3165s1c1
Sequence:CCGGCCGTGGTTGAAGTTGACAAATCTCGAGATTTGTCAACTTCAACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks