EMAIL THIS PAGE TO A FRIEND

ZNF705D

zinc finger protein 705D

Synonyms: ZNF705C
Species: Human ZNF705D(728957)
UniProtKB ID: P0CH99, A8K971, A8MY01, Q2TAN0
Gene ID:
4 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2103115 Anti-LOC728957 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039615 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039615 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039615 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU228721 MISSION® esiRNA esiRNA targeting human ZNF705D human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039615
ZNF705D MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 705D
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039615.3-618s21c1
Sequence:CCGGTGGCGGGAAGGAAGAGTATTTCTCGAGAAATACTCTTCCTTCCCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039615.3-567s21c1
Sequence:CCGGCAGATAAGCAAATCCTATATACTCGAGTATATAGGATTTGCTTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039615.3-1088s21c1
Sequence:CCGGCACGGGAGAGAGACCATATAACTCGAGTTATATGGTCTCTCTCCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039615.3-795s21c1
Sequence:CCGGTGCACTCACAGTTCCACAATACTCGAGTATTGTGGAACTGTGAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039615.3-1716s21c1
Sequence:CCGGCTGTCAGCATAATCAACTAAACTCGAGTTTAGTTGATTATGCTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039615
ZNF705D MISSION shRNA shRNA Plasmid DNA
zinc finger protein 705D
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039615.3-618s21c1
Sequence:CCGGTGGCGGGAAGGAAGAGTATTTCTCGAGAAATACTCTTCCTTCCCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039615.3-567s21c1
Sequence:CCGGCAGATAAGCAAATCCTATATACTCGAGTATATAGGATTTGCTTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039615.3-1088s21c1
Sequence:CCGGCACGGGAGAGAGACCATATAACTCGAGTTATATGGTCTCTCTCCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039615.3-795s21c1
Sequence:CCGGTGCACTCACAGTTCCACAATACTCGAGTATTGTGGAACTGTGAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039615.3-1716s21c1
Sequence:CCGGCTGTCAGCATAATCAACTAAACTCGAGTTTAGTTGATTATGCTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039615
ZNF705D MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 705D
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039615.3-618s21c1
Sequence:CCGGTGGCGGGAAGGAAGAGTATTTCTCGAGAAATACTCTTCCTTCCCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039615.3-567s21c1
Sequence:CCGGCAGATAAGCAAATCCTATATACTCGAGTATATAGGATTTGCTTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039615.3-1088s21c1
Sequence:CCGGCACGGGAGAGAGACCATATAACTCGAGTTATATGGTCTCTCTCCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039615.3-795s21c1
Sequence:CCGGTGCACTCACAGTTCCACAATACTCGAGTATTGTGGAACTGTGAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039615.3-1716s21c1
Sequence:CCGGCTGTCAGCATAATCAACTAAACTCGAGTTTAGTTGATTATGCTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks