EMAIL THIS PAGE TO A FRIEND

ZNF706

zinc finger protein 706

Synonyms: PNAS-106 PNAS-113
UniProtKB ID: Q9Y5V0, A8K362
Gene ID:
Zebrafish(402905) zinc finger protein 706
domestic cat(101098605) zinc finger protein 706
dog(607293) zinc finger protein 706
chicken(768824) zinc finger protein 706
cow(614279) zinc finger protein 706
sheep(101102740) zinc finger protein 706
domestic guinea pig(100726083) zinc finger protein 706
naked mole-rat(101722550) zinc finger protein 706
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV32987 Anti-ZNF706 antibody produced in rabbit affinity isolated antibody canine, rabbit, human, bovine, rat, guinea pig, horse, mouse
immunohistochemistry, western blot pricing
SAB2102946 Anti-ZNF706 antibody produced in rabbit affinity isolated antibody , human, rat, bovine, mouse, canine, horse, guinea pig, rabbit
western blot pricing
HPA042793 Anti-ZNF706 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016096 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016096 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016096 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108581 MISSION® esiRNA esiRNA human ZNF706 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042510 Rosetta Predictions human pricing
NM_001042511 Rosetta Predictions human pricing
NM_016096 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042510 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310238 predicted 1047
2 SASI_Hs02_00310239 predicted 682
3 SASI_Hs02_00310240 predicted 1030
4 SASI_Hs02_00310241 predicted 803
5 SASI_Hs02_00310242 predicted 663
6 SASI_Hs02_00310243 predicted 996
7 SASI_Hs02_00310244 predicted 678
8 SASI_Hs02_00310245 predicted 721
9 SASI_Hs02_00310246 predicted 652
10 SASI_Hs02_00310247 predicted 1048
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042511 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310248 predicted 848
2 SASI_Hs02_00310249 predicted 484
3 SASI_Hs02_00310250 predicted 829
4 SASI_Hs02_00310251 predicted 605
5 SASI_Hs02_00310252 predicted 465
6 SASI_Hs02_00310253 predicted 798
7 SASI_Hs02_00310254 predicted 478
8 SASI_Hs02_00310255 predicted 531
9 SASI_Hs02_00310256 predicted 459
10 SASI_Hs02_00310257 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016096 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243000 predicted 936
2 SASI_Hs02_00348859 predicted 565
3 SASI_Hs01_00243001 predicted 909
4 SASI_Hs01_00243002 predicted 690
5 SASI_Hs01_00243003 predicted 555
6 SASI_Hs01_00243004 predicted 885
7 SASI_Hs01_00243005 predicted 563
8 SASI_Hs01_00243008 predicted 615
9 SASI_Hs01_00243009 predicted 541
10 SASI_Hs02_00348860 predicted 937
11 SASI_Hs01_00243006 predicted 294
12 SASI_Hs01_00243007 predicted 347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016096
VALIDATED
ZNF706 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 706
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016096.3-642s21c1
Sequence:CCGGGGGCTACAGAAACACTCATTTCTCGAGAAATGAGTGTTTCTGTAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016096.3-437s1c1
Sequence:CCGGCACAAATGCCAGACCCTAAGACTCGAGTCTTAGGGTCTGGCATTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016096.3-521s1c1
Sequence:CCGGTTCAGGCATAAGGTTGTTTACCTCGAGGTAAACAACCTTATGCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016096.2-383s1c1
Sequence:CCGGCTTCCTCCAGAATTAGCTGATCTCGAGATCAGCTAATTCTGGAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129711    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016096.2-1879s1c1
Sequence:CCGGCCTATTCTTATGCCCTTACTTCTCGAGAAGTAAGGGCATAAGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016096.2-290s1c1
Sequence:CCGGGCCTTAATATATACCTGCACTCTCGAGAGTGCAGGTATATATTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016096
VALIDATED
ZNF706 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 706
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016096.3-642s21c1
Sequence:CCGGGGGCTACAGAAACACTCATTTCTCGAGAAATGAGTGTTTCTGTAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016096.3-437s1c1
Sequence:CCGGCACAAATGCCAGACCCTAAGACTCGAGTCTTAGGGTCTGGCATTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016096.3-521s1c1
Sequence:CCGGTTCAGGCATAAGGTTGTTTACCTCGAGGTAAACAACCTTATGCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016096.2-383s1c1
Sequence:CCGGCTTCCTCCAGAATTAGCTGATCTCGAGATCAGCTAATTCTGGAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129711    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016096.2-1879s1c1
Sequence:CCGGCCTATTCTTATGCCCTTACTTCTCGAGAAGTAAGGGCATAAGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016096.2-290s1c1
Sequence:CCGGGCCTTAATATATACCTGCACTCTCGAGAGTGCAGGTATATATTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016096
VALIDATED
ZNF706 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 706
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016096.3-642s21c1
Sequence:CCGGGGGCTACAGAAACACTCATTTCTCGAGAAATGAGTGTTTCTGTAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016096.3-437s1c1
Sequence:CCGGCACAAATGCCAGACCCTAAGACTCGAGTCTTAGGGTCTGGCATTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016096.3-521s1c1
Sequence:CCGGTTCAGGCATAAGGTTGTTTACCTCGAGGTAAACAACCTTATGCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016096.2-383s1c1
Sequence:CCGGCTTCCTCCAGAATTAGCTGATCTCGAGATCAGCTAATTCTGGAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129711    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016096.2-1879s1c1
Sequence:CCGGCCTATTCTTATGCCCTTACTTCTCGAGAAGTAAGGGCATAAGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016096.2-290s1c1
Sequence:CCGGGCCTTAATATATACCTGCACTCTCGAGAGTGCAGGTATATATTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks