EMAIL THIS PAGE TO A FRIEND

ZNF707

zinc finger protein 707

Species: Human ZNF707(286075), naked mole-rat Znf707(101717589), domestic guinea pig Znf707(101789012)
UniProtKB ID: Q96C28, A8K317, B3KNY1, D3DWK7
Gene ID:
naked mole-rat(101717589) zinc finger protein 707
domestic guinea pig(101789012) zinc finger protein 707
43 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173831 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173831 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173831 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100598 Rosetta Predictions human pricing
NM_001100599 Rosetta Predictions human pricing
NM_173831 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100598 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322204 predicted 749
2 SASI_Hs02_00322205 predicted 1816
3 SASI_Hs02_00322206 predicted 519
4 SASI_Hs02_00322207 predicted 686
5 SASI_Hs02_00322208 predicted 537
6 SASI_Hs02_00322209 predicted 1098
7 SASI_Hs02_00322210 predicted 734
8 SASI_Hs02_00322211 predicted 872
9 SASI_Hs02_00322212 predicted 1455
10 SASI_Hs02_00322213 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322214 predicted 653
2 SASI_Hs02_00322215 predicted 1712
3 SASI_Hs02_00322216 predicted 420
4 SASI_Hs02_00322217 predicted 586
5 SASI_Hs02_00322218 predicted 434
6 SASI_Hs02_00322219 predicted 996
7 SASI_Hs02_00322220 predicted 640
8 SASI_Hs02_00322221 predicted 773
9 SASI_Hs02_00322222 predicted 1366
10 SASI_Hs02_00322223 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173831 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368700 predicted 820
2 SASI_Hs01_00238978 predicted 1889
3 SASI_Hs02_00368701 predicted 588
4 SASI_Hs01_00238979 predicted 752
5 SASI_Hs02_00368702 predicted 606
6 SASI_Hs01_00238981 predicted 1170
7 SASI_Hs02_00368703 predicted 807
8 SASI_Hs01_00238982 predicted 938
9 SASI_Hs01_00238983 predicted 1532
10 SASI_Hs02_00368704 predicted 996
11 SASI_Hs01_00238976 predicted 556
12 SASI_Hs01_00238977 predicted 789
13 SASI_Hs01_00238980 predicted 788
14 SASI_Hs01_00238984 predicted 1160
15 SASI_Hs01_00238985 predicted 627
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173831
VALIDATED
ZNF707 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 707
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_173831.2-552s1c1
Sequence:CCGGCCCAAGAGACATTGTGATCATCTCGAGATGATCACAATGTCTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173831.2-616s1c1
Sequence:CCGGCCAGGGAAGGAAGCAGCTTTACTCGAGTAAAGCTGCTTCCTTCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173831.2-317s1c1
Sequence:CCGGCATCTACTTCTCAAGGGAGGACTCGAGTCCTCCCTTGAGAAGTAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_173831.2-785s1c1
Sequence:CCGGCGCAGTAGAGCTGTCGTTCATCTCGAGATGAACGACAGCTCTACTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_173831.2-1286s1c1
Sequence:CCGGGCACCTGACGAAGAGGTTCTACTCGAGTAGAACCTCTTCGTCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173831.3-350s21c1
Sequence:CCGGACGTGGCCATCTACTTCTCAACTCGAGTTGAGAAGTAGATGGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173831.3-2122s21c1
Sequence:CCGGCATATCCACCACATCGCATTTCTCGAGAAATGCGATGTGGTGGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173831.3-1121s21c1
Sequence:CCGGTCAAGCAGAAGTCCAACCTTCCTCGAGGAAGGTTGGACTTCTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173831.3-442s21c1
Sequence:CCGGAGTGTGGCTGCTCTGGGATTTCTCGAGAAATCCCAGAGCAGCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173831.3-825s21c1
Sequence:CCGGCGCAGTAGAGCTGTCATTCATCTCGAGATGAATGACAGCTCTACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173831
VALIDATED
ZNF707 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 707
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_173831.2-552s1c1
Sequence:CCGGCCCAAGAGACATTGTGATCATCTCGAGATGATCACAATGTCTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173831.2-616s1c1
Sequence:CCGGCCAGGGAAGGAAGCAGCTTTACTCGAGTAAAGCTGCTTCCTTCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173831.2-317s1c1
Sequence:CCGGCATCTACTTCTCAAGGGAGGACTCGAGTCCTCCCTTGAGAAGTAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_173831.2-785s1c1
Sequence:CCGGCGCAGTAGAGCTGTCGTTCATCTCGAGATGAACGACAGCTCTACTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_173831.2-1286s1c1
Sequence:CCGGGCACCTGACGAAGAGGTTCTACTCGAGTAGAACCTCTTCGTCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173831.3-350s21c1
Sequence:CCGGACGTGGCCATCTACTTCTCAACTCGAGTTGAGAAGTAGATGGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173831.3-2122s21c1
Sequence:CCGGCATATCCACCACATCGCATTTCTCGAGAAATGCGATGTGGTGGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173831.3-1121s21c1
Sequence:CCGGTCAAGCAGAAGTCCAACCTTCCTCGAGGAAGGTTGGACTTCTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173831.3-442s21c1
Sequence:CCGGAGTGTGGCTGCTCTGGGATTTCTCGAGAAATCCCAGAGCAGCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173831.3-825s21c1
Sequence:CCGGCGCAGTAGAGCTGTCATTCATCTCGAGATGAATGACAGCTCTACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173831
VALIDATED
ZNF707 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 707
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_173831.2-552s1c1
Sequence:CCGGCCCAAGAGACATTGTGATCATCTCGAGATGATCACAATGTCTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173831.2-616s1c1
Sequence:CCGGCCAGGGAAGGAAGCAGCTTTACTCGAGTAAAGCTGCTTCCTTCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173831.2-317s1c1
Sequence:CCGGCATCTACTTCTCAAGGGAGGACTCGAGTCCTCCCTTGAGAAGTAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_173831.2-785s1c1
Sequence:CCGGCGCAGTAGAGCTGTCGTTCATCTCGAGATGAACGACAGCTCTACTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_173831.2-1286s1c1
Sequence:CCGGGCACCTGACGAAGAGGTTCTACTCGAGTAGAACCTCTTCGTCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173831.3-350s21c1
Sequence:CCGGACGTGGCCATCTACTTCTCAACTCGAGTTGAGAAGTAGATGGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173831.3-2122s21c1
Sequence:CCGGCATATCCACCACATCGCATTTCTCGAGAAATGCGATGTGGTGGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173831.3-1121s21c1
Sequence:CCGGTCAAGCAGAAGTCCAACCTTCCTCGAGGAAGGTTGGACTTCTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173831.3-442s21c1
Sequence:CCGGAGTGTGGCTGCTCTGGGATTTCTCGAGAAATCCCAGAGCAGCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173831.3-825s21c1
Sequence:CCGGCGCAGTAGAGCTGTCATTCATCTCGAGATGAATGACAGCTCTACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks