EMAIL THIS PAGE TO A FRIEND

ZNF708

zinc finger protein 708

Synonyms: KOX8 ZNF15 ZNF15L1
UniProtKB ID: P17019, Q6ZMR0
Gene ID:
dog(484328) zinc finger protein 708
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV50663 Anti-ZNF708 antibody produced in rabbit affinity isolated antibody mouse, horse, rat, rabbit, bovine, human
western blot pricing
SAB2102947 Anti-ZNF708 antibody produced in rabbit affinity isolated antibody horse, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021269 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021269 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021269 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021269 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354926 predicted 819
2 SASI_Hs01_00232945 predicted 1413
3 SASI_Hs02_00354927 predicted 1655
4 SASI_Hs01_00232946 predicted 327
5 SASI_Hs01_00232947 predicted 319
6 SASI_Hs01_00232949 predicted 1408
7 SASI_Hs02_00354928 predicted 821
8 SASI_Hs01_00232950 predicted 1982
9 SASI_Hs01_00232952 predicted 1653
10 SASI_Hs01_00232948 predicted 566
11 SASI_Hs01_00232951 predicted 1392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021269
ZNF708 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 708
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021269.2-1653s21c1
Sequence:CCGGTATTCTGTCCTCTCATCTTACCTCGAGGTAAGATGAGAGGACAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021269.2-517s21c1
Sequence:CCGGGGATATCAGAAAGGCTGTAAACTCGAGTTTACAGCCTTTCTGATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021269.2-564s21c1
Sequence:CCGGAGGAGGTCACAAGGGACTTAACTCGAGTTAAGTCCCTTGTGACCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021269.2-3821s21c1
Sequence:CCGGTCTAAGTGGAGATGGTATTTGCTCGAGCAAATACCATCTCCACTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021269.2-448s21c1
Sequence:CCGGGACCTTAGGCCAGAGCAATATCTCGAGATATTGCTCTGGCCTAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021269.1-324s1c1
Sequence:CCGGCCTGGGTATTGCTGTGTCTAACTCGAGTTAGACACAGCAATACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159621    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021269.1-3720s1c1
Sequence:CCGGGCATCAAAGATAGGAGAGTTTCTCGAGAAACTCTCCTATCTTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159275    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021269.1-3140s1c1
Sequence:CCGGGCTTCAGACATTACACTATATCTCGAGATATAGTGTAATGTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158564    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021269.1-3186s1c1
Sequence:CCGGCCCAAACTAACGGTAGATAAACTCGAGTTTATCTACCGTTAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021269.1-1746s1c1
Sequence:CCGGCTCAACCCTTATGAAACATAACTCGAGTTATGTTTCATAAGGGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021269
ZNF708 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 708
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021269.2-1653s21c1
Sequence:CCGGTATTCTGTCCTCTCATCTTACCTCGAGGTAAGATGAGAGGACAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021269.2-517s21c1
Sequence:CCGGGGATATCAGAAAGGCTGTAAACTCGAGTTTACAGCCTTTCTGATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021269.2-564s21c1
Sequence:CCGGAGGAGGTCACAAGGGACTTAACTCGAGTTAAGTCCCTTGTGACCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021269.2-3821s21c1
Sequence:CCGGTCTAAGTGGAGATGGTATTTGCTCGAGCAAATACCATCTCCACTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021269.2-448s21c1
Sequence:CCGGGACCTTAGGCCAGAGCAATATCTCGAGATATTGCTCTGGCCTAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021269.1-324s1c1
Sequence:CCGGCCTGGGTATTGCTGTGTCTAACTCGAGTTAGACACAGCAATACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159621    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021269.1-3720s1c1
Sequence:CCGGGCATCAAAGATAGGAGAGTTTCTCGAGAAACTCTCCTATCTTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159275    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021269.1-3140s1c1
Sequence:CCGGGCTTCAGACATTACACTATATCTCGAGATATAGTGTAATGTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158564    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021269.1-3186s1c1
Sequence:CCGGCCCAAACTAACGGTAGATAAACTCGAGTTTATCTACCGTTAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021269.1-1746s1c1
Sequence:CCGGCTCAACCCTTATGAAACATAACTCGAGTTATGTTTCATAAGGGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021269
ZNF708 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 708
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021269.2-1653s21c1
Sequence:CCGGTATTCTGTCCTCTCATCTTACCTCGAGGTAAGATGAGAGGACAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021269.2-517s21c1
Sequence:CCGGGGATATCAGAAAGGCTGTAAACTCGAGTTTACAGCCTTTCTGATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021269.2-564s21c1
Sequence:CCGGAGGAGGTCACAAGGGACTTAACTCGAGTTAAGTCCCTTGTGACCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021269.2-3821s21c1
Sequence:CCGGTCTAAGTGGAGATGGTATTTGCTCGAGCAAATACCATCTCCACTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021269.2-448s21c1
Sequence:CCGGGACCTTAGGCCAGAGCAATATCTCGAGATATTGCTCTGGCCTAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021269.1-324s1c1
Sequence:CCGGCCTGGGTATTGCTGTGTCTAACTCGAGTTAGACACAGCAATACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159621    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021269.1-3720s1c1
Sequence:CCGGGCATCAAAGATAGGAGAGTTTCTCGAGAAACTCTCCTATCTTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159275    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021269.1-3140s1c1
Sequence:CCGGGCTTCAGACATTACACTATATCTCGAGATATAGTGTAATGTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158564    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021269.1-3186s1c1
Sequence:CCGGCCCAAACTAACGGTAGATAAACTCGAGTTTATCTACCGTTAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021269.1-1746s1c1
Sequence:CCGGCTCAACCCTTATGAAACATAACTCGAGTTATGTTTCATAAGGGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks