EMAIL THIS PAGE TO A FRIEND

ZNF709

zinc finger protein 709

UniProtKB ID: Q8N972, A8K4E6
Gene ID:
dog(484538) zinc finger protein 709
Horse(100065169) zinc finger protein 709
Horse(100056484) zinc finger protein 709
Horse(100065656) zinc finger protein 709
Horse(100064626) zinc finger protein 709
Horse(100066418) zinc finger protein 709
domestic guinea pig(100733589) zinc finger protein 709
naked mole-rat(101729393) zinc finger protein 709
Domestic Rabbit(100349963) zinc finger protein 709
cow(784148) zinc finger protein 709
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152601 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152601 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152601 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152601 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152601 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201897 predicted 610
2 SASI_Hs01_00201898 predicted 374
3 SASI_Hs01_00201899 predicted 1623
4 SASI_Hs01_00201900 predicted 1867
5 SASI_Hs01_00201901 predicted 347
6 SASI_Hs01_00201902 predicted 1019
7 SASI_Hs01_00201903 predicted 305
8 SASI_Hs01_00201904 predicted 536
9 SASI_Hs01_00201906 predicted 550
10 SASI_Hs02_00366448 predicted 2086
11 SASI_Hs01_00201905 predicted 1707
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152601
ZNF709 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 709
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152601.1-596s1c1
Sequence:CCGGCGAAGTTCATTTCGAATACATCTCGAGATGTATTCGAAATGAACTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152601.1-238s1c1
Sequence:CCGGGATGCAAGAAACCTTTGTTAACTCGAGTTAACAAAGGTTTCTTGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152601.1-465s1c1
Sequence:CCGGGAAAGGACTATATGTGTCATTCTCGAGAATGACACATATAGTCCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152601.1-837s1c1
Sequence:CCGGCGTTCAGTCATCCCAGTTCTTCTCGAGAAGAACTGGGATGACTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152601.1-1758s1c1
Sequence:CCGGAGGCGTTTAGTTGTTCCAGTTCTCGAGAACTGGAACAACTAAACGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152601.3-1453s21c1
Sequence:CCGGGTTCCAGTTCTGTTCGAATACCTCGAGGTATTCGAACAGAACTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152601.3-405s21c1
Sequence:CCGGACCATCAGTCAGACTCCAAATCTCGAGATTTGGAGTCTGACTGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152601.3-2286s21c1
Sequence:CCGGGAACGACCATGCCCACTTAATCTCGAGATTAAGTGGGCATGGTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152601.3-2041s21c1
Sequence:CCGGGTTCCCGTTCCTTTCGAATACCTCGAGGTATTCGAAAGGAACGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152601
ZNF709 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 709
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152601.1-596s1c1
Sequence:CCGGCGAAGTTCATTTCGAATACATCTCGAGATGTATTCGAAATGAACTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152601.1-238s1c1
Sequence:CCGGGATGCAAGAAACCTTTGTTAACTCGAGTTAACAAAGGTTTCTTGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152601.1-465s1c1
Sequence:CCGGGAAAGGACTATATGTGTCATTCTCGAGAATGACACATATAGTCCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152601.1-837s1c1
Sequence:CCGGCGTTCAGTCATCCCAGTTCTTCTCGAGAAGAACTGGGATGACTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152601.1-1758s1c1
Sequence:CCGGAGGCGTTTAGTTGTTCCAGTTCTCGAGAACTGGAACAACTAAACGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152601.3-1453s21c1
Sequence:CCGGGTTCCAGTTCTGTTCGAATACCTCGAGGTATTCGAACAGAACTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152601.3-405s21c1
Sequence:CCGGACCATCAGTCAGACTCCAAATCTCGAGATTTGGAGTCTGACTGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152601.3-2286s21c1
Sequence:CCGGGAACGACCATGCCCACTTAATCTCGAGATTAAGTGGGCATGGTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152601.3-2041s21c1
Sequence:CCGGGTTCCCGTTCCTTTCGAATACCTCGAGGTATTCGAAAGGAACGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152601
ZNF709 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 709
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152601.1-596s1c1
Sequence:CCGGCGAAGTTCATTTCGAATACATCTCGAGATGTATTCGAAATGAACTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152601.1-238s1c1
Sequence:CCGGGATGCAAGAAACCTTTGTTAACTCGAGTTAACAAAGGTTTCTTGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152601.1-465s1c1
Sequence:CCGGGAAAGGACTATATGTGTCATTCTCGAGAATGACACATATAGTCCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152601.1-837s1c1
Sequence:CCGGCGTTCAGTCATCCCAGTTCTTCTCGAGAAGAACTGGGATGACTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152601.1-1758s1c1
Sequence:CCGGAGGCGTTTAGTTGTTCCAGTTCTCGAGAACTGGAACAACTAAACGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152601.3-1453s21c1
Sequence:CCGGGTTCCAGTTCTGTTCGAATACCTCGAGGTATTCGAACAGAACTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152601.3-405s21c1
Sequence:CCGGACCATCAGTCAGACTCCAAATCTCGAGATTTGGAGTCTGACTGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152601.3-2286s21c1
Sequence:CCGGGAACGACCATGCCCACTTAATCTCGAGATTAAGTGGGCATGGTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152601.3-2041s21c1
Sequence:CCGGGTTCCCGTTCCTTTCGAATACCTCGAGGTATTCGAAAGGAACGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks