EMAIL THIS PAGE TO A FRIEND

ZNF70

zinc finger protein 70

Synonyms: Cos17
UniProtKB ID: Q9UC06
Gene ID:
Horse(100050702) zinc finger protein 70
domestic cat(101088622) zinc finger protein 70
dog(486410) zinc finger protein 70
domestic guinea pig(100729953) zinc finger protein 70
naked mole-rat(101701596) zinc finger protein 70
Domestic Rabbit(100349638) zinc finger protein 70
cow(538878) zinc finger protein 70
sheep(101118306) zinc finger protein 70
33 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021916 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021916 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021916 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000071 MISSION® esiRNA esiRNA targeting human ZNF70 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021916 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187336 predicted 1200
2 SASI_Hs01_00187337 predicted 764
3 SASI_Hs01_00187338 predicted 731
4 SASI_Hs01_00187339 predicted 1793
5 SASI_Hs01_00187340 predicted 1272
6 SASI_Hs01_00187341 predicted 571
7 SASI_Hs01_00187342 predicted 779
8 SASI_Hs01_00187343 predicted 1675
9 SASI_Hs01_00187344 predicted 713
10 SASI_Hs02_00355197 predicted 583
11 SASI_Hs01_00187345 predicted 474
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021916
VALIDATED
ZNF70 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 70
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_021916.2-3022s1c1
Sequence:CCGGCCTCTCATTGAACAGGGCTTTCTCGAGAAAGCCCTGTTCAATGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021916.2-497s1c1
Sequence:CCGGCTTTGCATTTGAGAACAGGTTCTCGAGAACCTGTTCTCAAATGCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_021916.2-1674s1c1
Sequence:CCGGGCCCTCATTGAGCACTATAAACTCGAGTTTATAGTGCTCAATGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_021916.2-676s1c1
Sequence:CCGGGCCCTGTTCAGCATCAAAGTACTCGAGTACTTTGATGCTGAACAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_021916.2-1285s1c1
Sequence:CCGGCCCTAAAGAAACCTCACGAGTCTCGAGACTCGTGAGGTTTCTTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_021916.2-762s21c1
Sequence:CCGGCTCAGCATGTGTCAGATAATCCTCGAGGATTATCTGACACATGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021916.2-1272s21c1
Sequence:CCGGCGGAAGATCCACACCCTAAAGCTCGAGCTTTAGGGTGTGGATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021916.2-1766s21c1
Sequence:CCGGTCGCCATCAGAAGATTCATTCCTCGAGGAATGAATCTTCTGATGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021916.2-2146s21c1
Sequence:CCGGAGAGGGAGAAAGTTGAATTAACTCGAGTTAATTCAACTTTCTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021916.2-1674s21c1
Sequence:CCGGGCCCTCATTGAGCACTATAAACTCGAGTTTATAGTGCTCAATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021916
VALIDATED
ZNF70 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 70
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_021916.2-3022s1c1
Sequence:CCGGCCTCTCATTGAACAGGGCTTTCTCGAGAAAGCCCTGTTCAATGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021916.2-497s1c1
Sequence:CCGGCTTTGCATTTGAGAACAGGTTCTCGAGAACCTGTTCTCAAATGCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_021916.2-1674s1c1
Sequence:CCGGGCCCTCATTGAGCACTATAAACTCGAGTTTATAGTGCTCAATGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_021916.2-676s1c1
Sequence:CCGGGCCCTGTTCAGCATCAAAGTACTCGAGTACTTTGATGCTGAACAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_021916.2-1285s1c1
Sequence:CCGGCCCTAAAGAAACCTCACGAGTCTCGAGACTCGTGAGGTTTCTTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_021916.2-762s21c1
Sequence:CCGGCTCAGCATGTGTCAGATAATCCTCGAGGATTATCTGACACATGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021916.2-1272s21c1
Sequence:CCGGCGGAAGATCCACACCCTAAAGCTCGAGCTTTAGGGTGTGGATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021916.2-1766s21c1
Sequence:CCGGTCGCCATCAGAAGATTCATTCCTCGAGGAATGAATCTTCTGATGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021916.2-2146s21c1
Sequence:CCGGAGAGGGAGAAAGTTGAATTAACTCGAGTTAATTCAACTTTCTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021916.2-1674s21c1
Sequence:CCGGGCCCTCATTGAGCACTATAAACTCGAGTTTATAGTGCTCAATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021916
VALIDATED
ZNF70 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 70
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_021916.2-3022s1c1
Sequence:CCGGCCTCTCATTGAACAGGGCTTTCTCGAGAAAGCCCTGTTCAATGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021916.2-497s1c1
Sequence:CCGGCTTTGCATTTGAGAACAGGTTCTCGAGAACCTGTTCTCAAATGCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_021916.2-1674s1c1
Sequence:CCGGGCCCTCATTGAGCACTATAAACTCGAGTTTATAGTGCTCAATGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_021916.2-676s1c1
Sequence:CCGGGCCCTGTTCAGCATCAAAGTACTCGAGTACTTTGATGCTGAACAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_021916.2-1285s1c1
Sequence:CCGGCCCTAAAGAAACCTCACGAGTCTCGAGACTCGTGAGGTTTCTTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_021916.2-762s21c1
Sequence:CCGGCTCAGCATGTGTCAGATAATCCTCGAGGATTATCTGACACATGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021916.2-1272s21c1
Sequence:CCGGCGGAAGATCCACACCCTAAAGCTCGAGCTTTAGGGTGTGGATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021916.2-1766s21c1
Sequence:CCGGTCGCCATCAGAAGATTCATTCCTCGAGGAATGAATCTTCTGATGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021916.2-2146s21c1
Sequence:CCGGAGAGGGAGAAAGTTGAATTAACTCGAGTTAATTCAACTTTCTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021916.2-1674s21c1
Sequence:CCGGGCCCTCATTGAGCACTATAAACTCGAGTTTATAGTGCTCAATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks