EMAIL THIS PAGE TO A FRIEND

ZNF710

zinc finger protein 710

UniProtKB ID: Q8N1W2, A0AVS3, Q6ZMK9, Q8NDU0
Gene ID:
cow(539500) zinc finger protein 710
sheep(101102592) zinc finger protein 710
naked mole-rat(101708319) zinc finger protein 710
domestic guinea pig(100726966) zinc finger protein 710
chicken(100858113) zinc finger protein 710
Horse(100069101) zinc finger protein 710
domestic cat(101082571) zinc finger protein 710
dog(488740) zinc finger protein 710
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198526 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198526 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198526 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU137941 MISSION® esiRNA esiRNA human ZNF710 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198526 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372106 predicted 868
2 SASI_Hs01_00216254 predicted 1501
3 SASI_Hs01_00216255 predicted 1901
4 SASI_Hs01_00216256 predicted 892
5 SASI_Hs01_00216257 predicted 1012
6 SASI_Hs01_00216258 predicted 1611
7 SASI_Hs01_00216259 predicted 2253
8 SASI_Hs01_00216261 predicted 2089
9 SASI_Hs02_00372107 predicted 573
10 SASI_Hs01_00216262 predicted 1715
11 SASI_Hs01_00216260 predicted 2503
12 SASI_Hs01_00216263 predicted 2534
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198526
ZNF710 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 710
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198526.1-1782s1c1
Sequence:CCGGGAAGTCCTTCAACCGCATGTACTCGAGTACATGCGGTTGAAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198526.1-444s1c1
Sequence:CCGGCAAGGTCAAGTTCGAGAAGGTCTCGAGACCTTCTCGAACTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198526.1-1312s1c1
Sequence:CCGGCACGAAGTGAAGCATGAGAGTCTCGAGACTCTCATGCTTCACTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198526.1-1029s1c1
Sequence:CCGGGTCCTACACGTCCAAGTACAACTCGAGTTGTACTTGGACGTGTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198526.1-1723s1c1
Sequence:CCGGCTCAAGACCCACATGATTGTACTCGAGTACAATCATGTGGGTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198526.1-475s1c1
Sequence:CCGGGAACAGGAGGTCTATGAGGTTCTCGAGAACCTCATAGACCTCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198526.1-1782s21c1
Sequence:CCGGGAAGTCCTTCAACCGCATGTACTCGAGTACATGCGGTTGAAGGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198526.1-1857s21c1
Sequence:CCGGCTACTGCTCCAGCAAGTTTAACTCGAGTTAAACTTGCTGGAGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198526.1-219s21c1
Sequence:CCGGGCTCTTTGGAGCTACCATAAGCTCGAGCTTATGGTAGCTCCAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198526.1-1748s21c1
Sequence:CCGGCGCCCGTGAAGCCATTCAAATCTCGAGATTTGAATGGCTTCACGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198526.1-2254s21c1
Sequence:CCGGTTGCACCACTAGGGACCTTTACTCGAGTAAAGGTCCCTAGTGGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198526
ZNF710 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 710
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198526.1-1782s1c1
Sequence:CCGGGAAGTCCTTCAACCGCATGTACTCGAGTACATGCGGTTGAAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198526.1-444s1c1
Sequence:CCGGCAAGGTCAAGTTCGAGAAGGTCTCGAGACCTTCTCGAACTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198526.1-1312s1c1
Sequence:CCGGCACGAAGTGAAGCATGAGAGTCTCGAGACTCTCATGCTTCACTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198526.1-1029s1c1
Sequence:CCGGGTCCTACACGTCCAAGTACAACTCGAGTTGTACTTGGACGTGTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198526.1-1723s1c1
Sequence:CCGGCTCAAGACCCACATGATTGTACTCGAGTACAATCATGTGGGTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198526.1-475s1c1
Sequence:CCGGGAACAGGAGGTCTATGAGGTTCTCGAGAACCTCATAGACCTCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198526.1-1782s21c1
Sequence:CCGGGAAGTCCTTCAACCGCATGTACTCGAGTACATGCGGTTGAAGGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198526.1-1857s21c1
Sequence:CCGGCTACTGCTCCAGCAAGTTTAACTCGAGTTAAACTTGCTGGAGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198526.1-219s21c1
Sequence:CCGGGCTCTTTGGAGCTACCATAAGCTCGAGCTTATGGTAGCTCCAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198526.1-1748s21c1
Sequence:CCGGCGCCCGTGAAGCCATTCAAATCTCGAGATTTGAATGGCTTCACGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198526.1-2254s21c1
Sequence:CCGGTTGCACCACTAGGGACCTTTACTCGAGTAAAGGTCCCTAGTGGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198526
ZNF710 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 710
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198526.1-1782s1c1
Sequence:CCGGGAAGTCCTTCAACCGCATGTACTCGAGTACATGCGGTTGAAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198526.1-444s1c1
Sequence:CCGGCAAGGTCAAGTTCGAGAAGGTCTCGAGACCTTCTCGAACTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198526.1-1312s1c1
Sequence:CCGGCACGAAGTGAAGCATGAGAGTCTCGAGACTCTCATGCTTCACTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198526.1-1029s1c1
Sequence:CCGGGTCCTACACGTCCAAGTACAACTCGAGTTGTACTTGGACGTGTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198526.1-1723s1c1
Sequence:CCGGCTCAAGACCCACATGATTGTACTCGAGTACAATCATGTGGGTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198526.1-475s1c1
Sequence:CCGGGAACAGGAGGTCTATGAGGTTCTCGAGAACCTCATAGACCTCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198526.1-1782s21c1
Sequence:CCGGGAAGTCCTTCAACCGCATGTACTCGAGTACATGCGGTTGAAGGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198526.1-1857s21c1
Sequence:CCGGCTACTGCTCCAGCAAGTTTAACTCGAGTTAAACTTGCTGGAGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198526.1-219s21c1
Sequence:CCGGGCTCTTTGGAGCTACCATAAGCTCGAGCTTATGGTAGCTCCAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198526.1-1748s21c1
Sequence:CCGGCGCCCGTGAAGCCATTCAAATCTCGAGATTTGAATGGCTTCACGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198526.1-2254s21c1
Sequence:CCGGTTGCACCACTAGGGACCTTTACTCGAGTAAAGGTCCCTAGTGGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks