EMAIL THIS PAGE TO A FRIEND

ZNF711

zinc finger protein 711

Synonyms: CMPX1 MRX97 ZNF4 ZNF5 ZNF6 Zfp711 dJ75N13.1
UniProtKB ID: Q9Y462, B4DSV4, Q6NX42, Q9Y4J6
Gene ID:
Human(7552) Summary: This gene encodes a zinc finger protein of unknown function. It bears similarity to a zinc finger protein which acts as a transcriptional activator. This gene lies in a region of the X chromosome which has been associated with mental retardation. [provided by RefSeq, Jul 2008]
Zebrafish(562505) zinc finger protein 711
Horse(100071705) zinc finger protein 711
domestic cat(101094911) zinc finger protein 711
dog(491993) zinc finger protein 711
chicken(422269) zinc finger protein 711
domestic guinea pig(100730001) zinc finger protein 711
naked mole-rat(101699333) zinc finger protein 711
Domestic Rabbit(100348024) zinc finger protein 711
cow(526026) zinc finger protein 711
sheep(101123608) zinc finger protein 711
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021998 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021998 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021998 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078321 MISSION® esiRNA esiRNA human ZNF711 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021998 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051958 predicted 1818
2 SASI_Hs01_00051959 predicted 2169
3 SASI_Hs02_00355365 predicted 2147
4 SASI_Hs01_00051961 predicted 600
5 SASI_Hs01_00051962 predicted 2124
6 SASI_Hs01_00051963 predicted 1653
7 SASI_Hs01_00051964 predicted 2621
8 SASI_Hs02_00355366 predicted 2726
9 SASI_Hs01_00051966 predicted 2052
10 SASI_Hs01_00051967 predicted 2697
11 SASI_Hs01_00051960 predicted 1218
12 SASI_Hs01_00051965 predicted 1320
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021998
VALIDATED
ZNF711 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 711
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021998.4-742s21c1
Sequence:CCGGACCTTGTTACTGGTCCTAATGCTCGAGCATTAGGACCAGTAACAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021998.4-1692s21c1
Sequence:CCGCACAGAATACACACGAAGATACCTCGAGGTATCTTCGTGTGTATTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021998.4-2090s21c1
Sequence:CCGGGGATTTGTTTCAAGGACATAACTCGAGTTATGTCCTTGAAACAAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021998.4-1968s21c1
Sequence:CCGGAGGTGTGCAGATCAATCAAATCTCGAGATTTGATTGATCTGCACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021998.4-2016s21c1
Sequence:CCGGGGTAACAATTTGCCATATAAACTCGAGTTTATATGGCAAATTGTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021998.4-394s21c1
Sequence:CCGGGAATGGCCCATACCATGATTACTCGAGTAATCATGGTATGGGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021998.4-1835s21c1
Sequence:CCGGGGCCGTTCACAGCAAGAATTTCTCGAGAAATTCTTGCTGTGAACGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021998.4-451s21c1
Sequence:CCGGATATCGATGGAGACCATATTGCTCGAGCAATATGGTCTCCATCGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021998.2-2416s1c1
Sequence:CCGGCGGCACATCATATCTGTCCATCTCGAGATGGACAGATATGATGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021998.2-1746s1c1
Sequence:CCGGCCCTTGCCATATTTGCACAAACTCGAGTTTGTGCAAATATGGCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_021998.2-2709s1c1
Sequence:CCGGCCAATGTGAGTATTGTGAATACTCGAGTATTCACAATACTCACATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021998.2-1100s1c1
Sequence:CCGGGCACTTCTGAAGACTACTTAACTCGAGTTAAGTAGTCTTCAGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021998.2-1387s1c1
Sequence:CCGGGCAGTTAAAGATTCTTCTCAACTCGAGTTGAGAAGAATCTTTAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021998
VALIDATED
ZNF711 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 711
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021998.4-742s21c1
Sequence:CCGGACCTTGTTACTGGTCCTAATGCTCGAGCATTAGGACCAGTAACAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021998.4-1692s21c1
Sequence:CCGCACAGAATACACACGAAGATACCTCGAGGTATCTTCGTGTGTATTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021998.4-2090s21c1
Sequence:CCGGGGATTTGTTTCAAGGACATAACTCGAGTTATGTCCTTGAAACAAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021998.4-1968s21c1
Sequence:CCGGAGGTGTGCAGATCAATCAAATCTCGAGATTTGATTGATCTGCACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021998.4-2016s21c1
Sequence:CCGGGGTAACAATTTGCCATATAAACTCGAGTTTATATGGCAAATTGTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021998.4-394s21c1
Sequence:CCGGGAATGGCCCATACCATGATTACTCGAGTAATCATGGTATGGGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021998.4-1835s21c1
Sequence:CCGGGGCCGTTCACAGCAAGAATTTCTCGAGAAATTCTTGCTGTGAACGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021998.4-451s21c1
Sequence:CCGGATATCGATGGAGACCATATTGCTCGAGCAATATGGTCTCCATCGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021998.2-2416s1c1
Sequence:CCGGCGGCACATCATATCTGTCCATCTCGAGATGGACAGATATGATGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021998.2-1746s1c1
Sequence:CCGGCCCTTGCCATATTTGCACAAACTCGAGTTTGTGCAAATATGGCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_021998.2-2709s1c1
Sequence:CCGGCCAATGTGAGTATTGTGAATACTCGAGTATTCACAATACTCACATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021998.2-1100s1c1
Sequence:CCGGGCACTTCTGAAGACTACTTAACTCGAGTTAAGTAGTCTTCAGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021998.2-1387s1c1
Sequence:CCGGGCAGTTAAAGATTCTTCTCAACTCGAGTTGAGAAGAATCTTTAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021998
VALIDATED
ZNF711 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 711
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021998.4-742s21c1
Sequence:CCGGACCTTGTTACTGGTCCTAATGCTCGAGCATTAGGACCAGTAACAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021998.4-1692s21c1
Sequence:CCGCACAGAATACACACGAAGATACCTCGAGGTATCTTCGTGTGTATTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021998.4-2090s21c1
Sequence:CCGGGGATTTGTTTCAAGGACATAACTCGAGTTATGTCCTTGAAACAAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021998.4-1968s21c1
Sequence:CCGGAGGTGTGCAGATCAATCAAATCTCGAGATTTGATTGATCTGCACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021998.4-2016s21c1
Sequence:CCGGGGTAACAATTTGCCATATAAACTCGAGTTTATATGGCAAATTGTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021998.4-394s21c1
Sequence:CCGGGAATGGCCCATACCATGATTACTCGAGTAATCATGGTATGGGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021998.4-1835s21c1
Sequence:CCGGGGCCGTTCACAGCAAGAATTTCTCGAGAAATTCTTGCTGTGAACGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021998.4-451s21c1
Sequence:CCGGATATCGATGGAGACCATATTGCTCGAGCAATATGGTCTCCATCGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021998.2-2416s1c1
Sequence:CCGGCGGCACATCATATCTGTCCATCTCGAGATGGACAGATATGATGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021998.2-1746s1c1
Sequence:CCGGCCCTTGCCATATTTGCACAAACTCGAGTTTGTGCAAATATGGCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_021998.2-2709s1c1
Sequence:CCGGCCAATGTGAGTATTGTGAATACTCGAGTATTCACAATACTCACATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021998.2-1100s1c1
Sequence:CCGGGCACTTCTGAAGACTACTTAACTCGAGTTAAGTAGTCTTCAGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021998.2-1387s1c1
Sequence:CCGGGCAGTTAAAGATTCTTCTCAACTCGAGTTGAGAAGAATCTTTAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks