EMAIL THIS PAGE TO A FRIEND

ZNF713

zinc finger protein 713

UniProtKB ID: Q8N859
Gene ID:
cow(100126443) zinc finger protein 713
sheep(101107495) zinc finger protein 713
Horse(100061119) zinc finger protein 713
domestic cat(101082966) zinc finger protein 713
dog(606818) zinc finger protein 713
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182633 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182633 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182633 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051261 MISSION® esiRNA esiRNA human ZNF713 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182633 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219896 predicted 1101
2 SASI_Hs01_00219897 predicted 534
3 SASI_Hs01_00219898 predicted 486
4 SASI_Hs01_00219899 predicted 1149
5 SASI_Hs01_00219900 predicted 254
6 SASI_Hs01_00219901 predicted 672
7 SASI_Hs01_00219902 predicted 889
8 SASI_Hs01_00219903 predicted 640
9 SASI_Hs01_00219904 predicted 290
10 SASI_Hs01_00219905 predicted 367
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182633
ZNF713 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 713
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182633.1-1758s1c1
Sequence:CCGGCAATGCGTAGAAACCAAATTACTCGAGTAATTTGGTTTCTACGCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182633.1-1263s1c1
Sequence:CCGGCGGGAGAAATTATGTGAATATCTCGAGATATTCACATAATTTCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182633.1-495s1c1
Sequence:CCGGCAAGTAACTTTGACCCACAAACTCGAGTTTGTGGGTCAAAGTTACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182633.1-662s1c1
Sequence:CCGGCTTGATTTACTATCAGGGAAACTCGAGTTTCCCTGATAGTAAATCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182633.1-254s1c1
Sequence:CCGGGCTAGAGGAAGAATGGGTGATCTCGAGATCACCCATTCTTCCTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182633.1-1786s21c1
Sequence:CCGGCCTTAAACTAGCAGCATATTACTCGAGTAATATGCTGCTAGTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182633.1-1299s21c1
Sequence:CCGGGTTCGCCACAGTCCTTCATTTCTCGAGAAATGAAGGACTGTGGCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182633.1-742s21c1
Sequence:CCGGTTCTTCTTACTGATCATATTCCTCGAGGAATATGATCAGTAAGAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182633
ZNF713 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 713
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182633.1-1758s1c1
Sequence:CCGGCAATGCGTAGAAACCAAATTACTCGAGTAATTTGGTTTCTACGCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182633.1-1263s1c1
Sequence:CCGGCGGGAGAAATTATGTGAATATCTCGAGATATTCACATAATTTCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182633.1-495s1c1
Sequence:CCGGCAAGTAACTTTGACCCACAAACTCGAGTTTGTGGGTCAAAGTTACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182633.1-662s1c1
Sequence:CCGGCTTGATTTACTATCAGGGAAACTCGAGTTTCCCTGATAGTAAATCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182633.1-254s1c1
Sequence:CCGGGCTAGAGGAAGAATGGGTGATCTCGAGATCACCCATTCTTCCTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182633.1-1786s21c1
Sequence:CCGGCCTTAAACTAGCAGCATATTACTCGAGTAATATGCTGCTAGTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182633.1-1299s21c1
Sequence:CCGGGTTCGCCACAGTCCTTCATTTCTCGAGAAATGAAGGACTGTGGCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182633.1-742s21c1
Sequence:CCGGTTCTTCTTACTGATCATATTCCTCGAGGAATATGATCAGTAAGAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182633
ZNF713 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 713
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182633.1-1758s1c1
Sequence:CCGGCAATGCGTAGAAACCAAATTACTCGAGTAATTTGGTTTCTACGCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182633.1-1263s1c1
Sequence:CCGGCGGGAGAAATTATGTGAATATCTCGAGATATTCACATAATTTCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182633.1-495s1c1
Sequence:CCGGCAAGTAACTTTGACCCACAAACTCGAGTTTGTGGGTCAAAGTTACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182633.1-662s1c1
Sequence:CCGGCTTGATTTACTATCAGGGAAACTCGAGTTTCCCTGATAGTAAATCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182633.1-254s1c1
Sequence:CCGGGCTAGAGGAAGAATGGGTGATCTCGAGATCACCCATTCTTCCTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182633.1-1786s21c1
Sequence:CCGGCCTTAAACTAGCAGCATATTACTCGAGTAATATGCTGCTAGTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182633.1-1299s21c1
Sequence:CCGGGTTCGCCACAGTCCTTCATTTCTCGAGAAATGAAGGACTGTGGCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182633.1-742s21c1
Sequence:CCGGTTCTTCTTACTGATCATATTCCTCGAGGAATATGATCAGTAAGAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks