EMAIL THIS PAGE TO A FRIEND

ZNF714

zinc finger protein 714

Species: Human ZNF714(148206)
UniProtKB ID: Q96N38, Q49AI1, Q86W65, Q8ND40
Gene ID:
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102949 Anti-ZNF714 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182515 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182515 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182515 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106701 MISSION® esiRNA esiRNA human ZNF431 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182515 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235877 predicted 1402
2 SASI_Hs01_00235878 predicted 900
3 SASI_Hs02_00370594 predicted 617
4 SASI_Hs01_00235879 predicted 1182
5 SASI_Hs02_00370595 predicted 624
6 SASI_Hs02_00370596 predicted 625
7 SASI_Hs01_00235880 predicted 894
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182515
ZNF714 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 714
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182515.1-1301s1c1
Sequence:CCGGGCAAAGGCTTTAACTGGTCTTCTCGAGAAGACCAGTTAAAGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182515.1-864s1c1
Sequence:CCGGCCAATGTGAAGAATGTGACAACTCGAGTTGTCACATTCTTCACATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182515.1-2279s1c1
Sequence:CCGGGCAAAGCCTTTAACCAGTCTTCTCGAGAAGACTGGTTAAAGGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182515.1-1655s1c1
Sequence:CCGGCCTCAAACCTTACTACACATACTCGAGTATGTGTAGTAAGGTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183765    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182515.1-2379s1c1
Sequence:CCGGCCCTCAATTCTTAACAGACATCTCGAGATGTCTGTTAAGAATTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179291    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182515.1-2367s1c1
Sequence:CCGGGCCTTTAACAAGCCCTCAATTCTCGAGAATTGAGGGCTTGTTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182515
ZNF714 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 714
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182515.1-1301s1c1
Sequence:CCGGGCAAAGGCTTTAACTGGTCTTCTCGAGAAGACCAGTTAAAGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182515.1-864s1c1
Sequence:CCGGCCAATGTGAAGAATGTGACAACTCGAGTTGTCACATTCTTCACATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182515.1-2279s1c1
Sequence:CCGGGCAAAGCCTTTAACCAGTCTTCTCGAGAAGACTGGTTAAAGGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182515.1-1655s1c1
Sequence:CCGGCCTCAAACCTTACTACACATACTCGAGTATGTGTAGTAAGGTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183765    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182515.1-2379s1c1
Sequence:CCGGCCCTCAATTCTTAACAGACATCTCGAGATGTCTGTTAAGAATTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179291    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182515.1-2367s1c1
Sequence:CCGGGCCTTTAACAAGCCCTCAATTCTCGAGAATTGAGGGCTTGTTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182515
ZNF714 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 714
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182515.1-1301s1c1
Sequence:CCGGGCAAAGGCTTTAACTGGTCTTCTCGAGAAGACCAGTTAAAGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182515.1-864s1c1
Sequence:CCGGCCAATGTGAAGAATGTGACAACTCGAGTTGTCACATTCTTCACATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182515.1-2279s1c1
Sequence:CCGGGCAAAGCCTTTAACCAGTCTTCTCGAGAAGACTGGTTAAAGGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182515.1-1655s1c1
Sequence:CCGGCCTCAAACCTTACTACACATACTCGAGTATGTGTAGTAAGGTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183765    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182515.1-2379s1c1
Sequence:CCGGCCCTCAATTCTTAACAGACATCTCGAGATGTCTGTTAAGAATTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179291    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182515.1-2367s1c1
Sequence:CCGGGCCTTTAACAAGCCCTCAATTCTCGAGAATTGAGGGCTTGTTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks