EMAIL THIS PAGE TO A FRIEND

ZNF716

zinc finger protein 716

Species: Human ZNF716(441234)
UniProtKB ID: A6NP11
Gene ID:
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001714654 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001714654 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001714654 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714654 Rosetta Predictions human pricing
XM_001714670 Rosetta Predictions human pricing
XM_001719202 Rosetta Predictions human pricing
XM_496879 Rosetta Predictions human pricing
XM_938124 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714654 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00398556 predicted 521
2 SASI_Hs02_00398557 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00398647 predicted 525
2 SASI_Hs02_00398648 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00428809 predicted 523
2 SASI_Hs02_00428810 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496879 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00277917 predicted 524
2 SASI_Hs01_00277918 predicted 1652
3 SASI_Hs01_00277919 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_938124 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482928 predicted 2825
2 SASI_Hs02_00482929 predicted 2286
3 SASI_Hs02_00482930 predicted 2148
4 SASI_Hs02_00482931 predicted 2385
5 SASI_Hs02_00482932 predicted 2345
6 SASI_Hs02_00482933 predicted 2823
7 SASI_Hs02_00482934 predicted 2031
8 SASI_Hs02_00482935 predicted 2381
9 SASI_Hs02_00482936 predicted 2255
10 SASI_Hs02_00482937 predicted 2013
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001714654
ZNF716 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 716
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714654.1-463s21c1
Sequence:CCGGACAGGAGGATTTACAAGTAAACTCGAGTTTACTTGTAAATCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714654.1-591s21c1
Sequence:GTACCGGGCGTCAAAGTCTTTGGTAAATCTCGAGATTTACCAAAGACTTTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714654.1-1028s21c1
Sequence:CCGGTTACCCTCAACCTTCACTTACCTCGAGGTAAGTGAAGGTTGAGGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714654.1-940s21c1
Sequence:CCGGTACCTTCTCCTCAACTCTAAACTCGAGTTTAGAGTTGAGGAGAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714654.1-524s21c1
Sequence:CCGGGGAGGTTATAATTATGTTAACCTCGAGGTTAACATAATTATAACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001714654
ZNF716 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 716
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714654.1-463s21c1
Sequence:CCGGACAGGAGGATTTACAAGTAAACTCGAGTTTACTTGTAAATCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714654.1-591s21c1
Sequence:GTACCGGGCGTCAAAGTCTTTGGTAAATCTCGAGATTTACCAAAGACTTTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714654.1-1028s21c1
Sequence:CCGGTTACCCTCAACCTTCACTTACCTCGAGGTAAGTGAAGGTTGAGGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714654.1-940s21c1
Sequence:CCGGTACCTTCTCCTCAACTCTAAACTCGAGTTTAGAGTTGAGGAGAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714654.1-524s21c1
Sequence:CCGGGGAGGTTATAATTATGTTAACCTCGAGGTTAACATAATTATAACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001714654
ZNF716 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 716
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714654.1-463s21c1
Sequence:CCGGACAGGAGGATTTACAAGTAAACTCGAGTTTACTTGTAAATCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714654.1-591s21c1
Sequence:GTACCGGGCGTCAAAGTCTTTGGTAAATCTCGAGATTTACCAAAGACTTTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714654.1-1028s21c1
Sequence:CCGGTTACCCTCAACCTTCACTTACCTCGAGGTAAGTGAAGGTTGAGGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714654.1-940s21c1
Sequence:CCGGTACCTTCTCCTCAACTCTAAACTCGAGTTTAGAGTTGAGGAGAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714654.1-524s21c1
Sequence:CCGGGGAGGTTATAATTATGTTAACCTCGAGGTTAACATAATTATAACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks