EMAIL THIS PAGE TO A FRIEND

ZNF717

zinc finger protein 717

Synonyms: X17 ZNF838
Species: Human ZNF717(100131827), naked mole-rat Znf717(101701676), domestic guinea pig Znf717(100725563)
UniProtKB ID: Q9BY31
Gene ID:
naked mole-rat(101701676) zinc finger protein 717
domestic guinea pig(100725563) zinc finger protein 717
12 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001128223 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001128223 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001128223 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128223 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330946 predicted 584
2 SASI_Hs02_00330947 predicted 1957
3 SASI_Hs02_00330948 predicted 1180
4 SASI_Hs02_00330949 predicted 1604
5 SASI_Hs02_00330950 predicted 1785
6 SASI_Hs02_00330951 predicted 596
7 SASI_Hs02_00330952 predicted 2717
8 SASI_Hs02_00330953 predicted 1046
9 SASI_Hs02_00330954 predicted 1113
10 SASI_Hs02_00330955 predicted 1793
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001128223
ZNF717 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 717
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128223.1-2043s21c1
Sequence:CCGGTGTAAGTCATTCCTAACTATACTCGAGTATAGTTAGGAATGACTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128223.1-595s21c1
Sequence:CCGGTTTCAGCTGTCCAGATCATTGCTCGAGCAATGATCTGGACAGCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128223.1-2376s21c1
Sequence:CCGGGTCAGAAATCATACCTTATTACTCGAGTAATAAGGTATGATTTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128223.1-783s21c1
Sequence:CCGGATGAAGCCTGGGCAGTTTAATCTCGAGATTAAACTGCCCAGGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128223.1-2552s21c1
Sequence:CCGGAGTCCTCACTGTACATCATAGCTCGAGCTATGATGTACAGTGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001128223
ZNF717 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 717
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128223.1-2043s21c1
Sequence:CCGGTGTAAGTCATTCCTAACTATACTCGAGTATAGTTAGGAATGACTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128223.1-595s21c1
Sequence:CCGGTTTCAGCTGTCCAGATCATTGCTCGAGCAATGATCTGGACAGCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128223.1-2376s21c1
Sequence:CCGGGTCAGAAATCATACCTTATTACTCGAGTAATAAGGTATGATTTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128223.1-783s21c1
Sequence:CCGGATGAAGCCTGGGCAGTTTAATCTCGAGATTAAACTGCCCAGGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128223.1-2552s21c1
Sequence:CCGGAGTCCTCACTGTACATCATAGCTCGAGCTATGATGTACAGTGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001128223
ZNF717 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 717
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128223.1-2043s21c1
Sequence:CCGGTGTAAGTCATTCCTAACTATACTCGAGTATAGTTAGGAATGACTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128223.1-595s21c1
Sequence:CCGGTTTCAGCTGTCCAGATCATTGCTCGAGCAATGATCTGGACAGCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128223.1-2376s21c1
Sequence:CCGGGTCAGAAATCATACCTTATTACTCGAGTAATAAGGTATGATTTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128223.1-783s21c1
Sequence:CCGGATGAAGCCTGGGCAGTTTAATCTCGAGATTAAACTGCCCAGGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128223.1-2552s21c1
Sequence:CCGGAGTCCTCACTGTACATCATAGCTCGAGCTATGATGTACAGTGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks