EMAIL THIS PAGE TO A FRIEND

ZNF718

zinc finger protein 718

Species: Human ZNF718(255403)
UniProtKB ID: Q3SXZ3, Q3SXZ4, Q3SXZ5
Gene ID:
15 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1402070 Anti-ZNF718 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153691 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153691 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153691 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039127 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020811 predicted 1339
2 SASI_Hs01_00020813 predicted 510
3 SASI_Hs01_00020814 predicted 1348
4 SASI_Hs01_00020815 predicted 1348
5 SASI_Hs01_00020816 predicted 502
6 SASI_Hs01_00020817 predicted 1267
7 SASI_Hs01_00020819 predicted 559
8 SASI_Hs01_00020812 predicted 951
9 SASI_Hs01_00020818 predicted 533
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153691
ZNF718 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 718
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164124    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153691.3-2103s1c1
Sequence:CCGGCTGGAGAGAAACCCTACATATCTCGAGATATGTAGGGTTTCTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158538    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153691.3-1650s1c1
Sequence:CCGGCCTCAACCCTTAATTTACATACTCGAGTATGTAAATTAAGGGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161124    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153691.3-2066s1c1
Sequence:CCGGGTGTTTGCAAACCTGCATAATCTCGAGATTATGCAGGTTTGCAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159583    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153691.3-1740s1c1
Sequence:CCGGCCCTTAATGAACATAAGAGAACTCGAGTTCTCTTATGTTCATTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162253    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153691.3-1818s1c1
Sequence:CCGGCCTCAGACTTTGCTAAACATACTCGAGTATGTTTAGCAAAGTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153691
ZNF718 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 718
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164124    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153691.3-2103s1c1
Sequence:CCGGCTGGAGAGAAACCCTACATATCTCGAGATATGTAGGGTTTCTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158538    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153691.3-1650s1c1
Sequence:CCGGCCTCAACCCTTAATTTACATACTCGAGTATGTAAATTAAGGGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161124    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153691.3-2066s1c1
Sequence:CCGGGTGTTTGCAAACCTGCATAATCTCGAGATTATGCAGGTTTGCAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159583    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153691.3-1740s1c1
Sequence:CCGGCCCTTAATGAACATAAGAGAACTCGAGTTCTCTTATGTTCATTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162253    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153691.3-1818s1c1
Sequence:CCGGCCTCAGACTTTGCTAAACATACTCGAGTATGTTTAGCAAAGTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153691
ZNF718 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 718
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164124    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153691.3-2103s1c1
Sequence:CCGGCTGGAGAGAAACCCTACATATCTCGAGATATGTAGGGTTTCTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158538    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153691.3-1650s1c1
Sequence:CCGGCCTCAACCCTTAATTTACATACTCGAGTATGTAAATTAAGGGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161124    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153691.3-2066s1c1
Sequence:CCGGGTGTTTGCAAACCTGCATAATCTCGAGATTATGCAGGTTTGCAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159583    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153691.3-1740s1c1
Sequence:CCGGCCCTTAATGAACATAAGAGAACTCGAGTTCTCTTATGTTCATTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162253    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153691.3-1818s1c1
Sequence:CCGGCCTCAGACTTTGCTAAACATACTCGAGTATGTTTAGCAAAGTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks