EMAIL THIS PAGE TO A FRIEND

ZNF71

zinc finger protein 71

Synonyms: EZFIT
UniProtKB ID: Q9NQZ8, Q15919, Q9UC09, Q9UQD3
Gene ID:
chicken(425244) zinc finger protein 71
Horse(100058266) zinc finger protein 71
cow(509356) zinc finger protein 71
sheep(101110701) zinc finger protein 71
30 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021216 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021216 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021216 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016401 MISSION® esiRNA esiRNA targeting human ZNF71 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021216 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021216 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190338 predicted 2034
2 SASI_Hs01_00190339 predicted 455
3 SASI_Hs01_00190341 predicted 1961
4 SASI_Hs02_00354824 predicted 339
5 SASI_Hs01_00190345 predicted 985
6 SASI_Hs02_00354825 predicted 1651
7 SASI_Hs01_00190346 predicted 1745
8 SASI_Hs02_00354826 predicted 1972
9 SASI_Hs02_00354827 predicted 264
10 SASI_Hs02_00354828 predicted 1989
11 SASI_Hs01_00190337 predicted 682
12 SASI_Hs01_00190340 predicted 528
13 SASI_Hs01_00190342 predicted 524
14 SASI_Hs01_00190343 predicted 1394
15 SASI_Hs01_00190344 predicted 630
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021216
VALIDATED
ZNF71 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 71
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021216.4-400s21c1
Sequence:CCGGAGAGTGGGAGCCATTGGGAATCTCGAGATTCCCAATGGCTCCCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021216.4-2132s21c1
Sequence:CCGGAGCTTGTCACCATCTGCATTTCTCGAGAAATGCAGATGGTGACAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021216.4-454s21c1
Sequence:CCGGACCCGCATGTCATGAACTGAACTCGAGTTCAGTTCATGACATGCGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021216.3-1539s1c1
Sequence:CCGGCGGGAAGTCCTTCATCAAGAACTCGAGTTCTTGATGAAGGACTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_021216.3-1245s1c1
Sequence:CCGGGCGCTTCCACATCGGCGTGAACTCGAGTTCACGCCGATGTGGAAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021216.3-642s1c1
Sequence:CCGGCCTGATAAAGCACCAAAGGATCTCGAGATCCTTTGGTGCTTTATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021216.3-244s1c1
Sequence:CCGGGAAGACAAGCTCTCCGTTGTTCTCGAGAACAACGGAGAGCTTGTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_021216.3-533s1c1
Sequence:CCGGGCAAGAACTTCTCCAGCACTTCTCGAGAAGTGCTGGAGAAGTTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021216
VALIDATED
ZNF71 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 71
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021216.4-400s21c1
Sequence:CCGGAGAGTGGGAGCCATTGGGAATCTCGAGATTCCCAATGGCTCCCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021216.4-2132s21c1
Sequence:CCGGAGCTTGTCACCATCTGCATTTCTCGAGAAATGCAGATGGTGACAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021216.4-454s21c1
Sequence:CCGGACCCGCATGTCATGAACTGAACTCGAGTTCAGTTCATGACATGCGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021216.3-1539s1c1
Sequence:CCGGCGGGAAGTCCTTCATCAAGAACTCGAGTTCTTGATGAAGGACTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_021216.3-1245s1c1
Sequence:CCGGGCGCTTCCACATCGGCGTGAACTCGAGTTCACGCCGATGTGGAAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021216.3-642s1c1
Sequence:CCGGCCTGATAAAGCACCAAAGGATCTCGAGATCCTTTGGTGCTTTATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021216.3-244s1c1
Sequence:CCGGGAAGACAAGCTCTCCGTTGTTCTCGAGAACAACGGAGAGCTTGTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_021216.3-533s1c1
Sequence:CCGGGCAAGAACTTCTCCAGCACTTCTCGAGAAGTGCTGGAGAAGTTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021216
VALIDATED
ZNF71 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 71
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021216.4-400s21c1
Sequence:CCGGAGAGTGGGAGCCATTGGGAATCTCGAGATTCCCAATGGCTCCCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021216.4-2132s21c1
Sequence:CCGGAGCTTGTCACCATCTGCATTTCTCGAGAAATGCAGATGGTGACAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021216.4-454s21c1
Sequence:CCGGACCCGCATGTCATGAACTGAACTCGAGTTCAGTTCATGACATGCGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021216.3-1539s1c1
Sequence:CCGGCGGGAAGTCCTTCATCAAGAACTCGAGTTCTTGATGAAGGACTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_021216.3-1245s1c1
Sequence:CCGGGCGCTTCCACATCGGCGTGAACTCGAGTTCACGCCGATGTGGAAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021216.3-642s1c1
Sequence:CCGGCCTGATAAAGCACCAAAGGATCTCGAGATCCTTTGGTGCTTTATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021216.3-244s1c1
Sequence:CCGGGAAGACAAGCTCTCCGTTGTTCTCGAGAACAACGGAGAGCTTGTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_021216.3-533s1c1
Sequence:CCGGGCAAGAACTTCTCCAGCACTTCTCGAGAAGTGCTGGAGAAGTTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks