EMAIL THIS PAGE TO A FRIEND

ZNF720

zinc finger protein 720

Species: Human ZNF720(124411)
UniProtKB ID: Q7Z2F6, Q6ZQX1
Gene ID:
299 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004300 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004300 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004300 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004300 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198629 predicted 946
2 SASI_Hs01_00198630 predicted 937
3 SASI_Hs01_00198631 predicted 223
4 SASI_Hs01_00198632 predicted 225
5 SASI_Hs01_00198633 predicted 957
6 SASI_Hs01_00198634 predicted 1015
7 SASI_Hs01_00198635 predicted 217
8 SASI_Hs01_00198636 predicted 845
9 SASI_Hs01_00198637 predicted 410
10 SASI_Hs01_00198638 predicted 680
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004300
VALIDATED
ZNF720 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 720
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000117797    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001004300.1-946s1c1
Sequence:CCGGGCTGGTTCTATTCCTCAGTTACTCGAGTAACTGAGGAATAGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004300.1-410s1c1
Sequence:CCGGGCCTCTTAAGAAAGAAGCTTACTCGAGTAAGCTTCTTTCTTAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001004300.1-423s1c1
Sequence:CCGGGAAGCTTATAGAAGCATCATTCTCGAGAATGATGCTTCTATAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004300.1-216s1c1
Sequence:CCGGACACCTGGACTCAGATCAGAACTCGAGTTCTGATCTGAGTCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004300
VALIDATED
ZNF720 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 720
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000117797    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001004300.1-946s1c1
Sequence:CCGGGCTGGTTCTATTCCTCAGTTACTCGAGTAACTGAGGAATAGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004300.1-410s1c1
Sequence:CCGGGCCTCTTAAGAAAGAAGCTTACTCGAGTAAGCTTCTTTCTTAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001004300.1-423s1c1
Sequence:CCGGGAAGCTTATAGAAGCATCATTCTCGAGAATGATGCTTCTATAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004300.1-216s1c1
Sequence:CCGGACACCTGGACTCAGATCAGAACTCGAGTTCTGATCTGAGTCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004300
VALIDATED
ZNF720 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 720
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000117797    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001004300.1-946s1c1
Sequence:CCGGGCTGGTTCTATTCCTCAGTTACTCGAGTAACTGAGGAATAGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004300.1-410s1c1
Sequence:CCGGGCCTCTTAAGAAAGAAGCTTACTCGAGTAAGCTTCTTTCTTAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001004300.1-423s1c1
Sequence:CCGGGAAGCTTATAGAAGCATCATTCTCGAGAATGATGCTTCTATAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004300.1-216s1c1
Sequence:CCGGACACCTGGACTCAGATCAGAACTCGAGTTCTGATCTGAGTCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks