EMAIL THIS PAGE TO A FRIEND

ZNF721

zinc finger protein 721

Species: Human ZNF721(170960)
UniProtKB ID: Q8TF20, Q69YG7
Gene ID:
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA065313 Anti-ZNF721 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133474 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133474 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133474 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133474 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363179 predicted 3215
2 SASI_Hs02_00363180 predicted 2797
3 SASI_Hs02_00363181 predicted 3538
4 SASI_Hs02_00363182 predicted 2899
5 SASI_Hs02_00363183 predicted 3230
6 SASI_Hs02_00363184 predicted 3307
7 SASI_Hs02_00363185 predicted 3530
8 SASI_Hs02_00363186 predicted 2812
9 SASI_Hs02_00363187 predicted 3321
10 SASI_Hs01_00244736 predicted 1217
11 SASI_Hs01_00244734 predicted 1384
12 SASI_Hs01_00244735 predicted 207
13 SASI_Hs01_00244737 predicted 1310
14 SASI_Hs01_00244738 predicted 1227
15 SASI_Hs01_00244739 predicted 801
16 SASI_Hs01_00244740 predicted 1378
17 SASI_Hs01_00244741 predicted 627
18 SASI_Hs01_00244742 predicted 865
19 SASI_Hs01_00244743 predicted 842
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133474
ZNF721 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 721
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133474.1-2064s1c1
Sequence:CCGGGCCCTGAATCAACACAAGAAACTCGAGTTTCTTGTGTTGATTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133474.1-1242s1c1
Sequence:CCGGGAATTCACACTAGGAGGAGAACTCGAGTTCTCCTCCTAGTGTGAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133474.1-181s1c1
Sequence:CCGGGAACGTGTGTAAAGTGCAGAACTCGAGTTCTGCACTTTACACACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133474.1-599s1c1
Sequence:CCGGGAAGATCGTGACAGAGCCTTTCTCGAGAAAGGCTCTGTCACGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133474.1-1226s1c1
Sequence:CCGGGACTGCAACATGAAGAGAATTCTCGAGAATTCTCTTCATGTTGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133474
ZNF721 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 721
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133474.1-2064s1c1
Sequence:CCGGGCCCTGAATCAACACAAGAAACTCGAGTTTCTTGTGTTGATTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133474.1-1242s1c1
Sequence:CCGGGAATTCACACTAGGAGGAGAACTCGAGTTCTCCTCCTAGTGTGAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133474.1-181s1c1
Sequence:CCGGGAACGTGTGTAAAGTGCAGAACTCGAGTTCTGCACTTTACACACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133474.1-599s1c1
Sequence:CCGGGAAGATCGTGACAGAGCCTTTCTCGAGAAAGGCTCTGTCACGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133474.1-1226s1c1
Sequence:CCGGGACTGCAACATGAAGAGAATTCTCGAGAATTCTCTTCATGTTGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133474
ZNF721 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 721
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133474.1-2064s1c1
Sequence:CCGGGCCCTGAATCAACACAAGAAACTCGAGTTTCTTGTGTTGATTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133474.1-1242s1c1
Sequence:CCGGGAATTCACACTAGGAGGAGAACTCGAGTTCTCCTCCTAGTGTGAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133474.1-181s1c1
Sequence:CCGGGAACGTGTGTAAAGTGCAGAACTCGAGTTCTGCACTTTACACACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133474.1-599s1c1
Sequence:CCGGGAAGATCGTGACAGAGCCTTTCTCGAGAAAGGCTCTGTCACGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133474.1-1226s1c1
Sequence:CCGGGACTGCAACATGAAGAGAATTCTCGAGAATTCTCTTCATGTTGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks