EMAIL THIS PAGE TO A FRIEND

ZNF727

zinc finger protein 727

Species: Human ZNF727(442319)
UniProtKB ID: A8MUV8
Gene ID:
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001159522 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001159522 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001159522 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001719625 Rosetta Predictions human pricing
XM_001720070 Rosetta Predictions human pricing
XR_016680 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00431591 predicted 797
2 SASI_Hs02_00431592 predicted 914
3 SASI_Hs02_00431593 predicted 2215
4 SASI_Hs02_00431594 predicted 2217
5 SASI_Hs02_00431595 predicted 778
6 SASI_Hs02_00431596 predicted 1158
7 SASI_Hs02_00431597 predicted 921
8 SASI_Hs02_00431598 predicted 1185
9 SASI_Hs02_00431599 predicted 863
10 SASI_Hs02_00431600 predicted 1462
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00434319 predicted 798
2 SASI_Hs02_00434320 predicted 913
3 SASI_Hs02_00434321 predicted 2214
4 SASI_Hs02_00434322 predicted 2211
5 SASI_Hs02_00434323 predicted 782
6 SASI_Hs02_00434324 predicted 1160
7 SASI_Hs02_00434325 predicted 919
8 SASI_Hs02_00434326 predicted 1183
9 SASI_Hs02_00434327 predicted 861
10 SASI_Hs02_00434328 predicted 1470
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_016680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00491426 predicted 920
2 SASI_Hs02_00491427 predicted 801
3 SASI_Hs02_00491428 predicted 915
4 SASI_Hs02_00491429 predicted 861
5 SASI_Hs02_00491430 predicted 2207
6 SASI_Hs02_00491431 predicted 2436
7 SASI_Hs02_00491432 predicted 74
8 SASI_Hs02_00491433 predicted 2212
9 SASI_Hs02_00491434 predicted 2540
10 SASI_Hs02_00491435 predicted 1162
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001159522
ZNF727 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 727
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159522.1-974s21c1
Sequence:CCGGTAGGTGTTGCTCAGACCTTACCTCGAGGTAAGGTCTGAGCAACACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159522.1-434s21c1
Sequence:CCGGATTGCTGGAGCACGACATAAACTCGAGTTTATGTCGTGCTCCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159522.1-715s21c1
Sequence:CCGGGCAAAGACTGTAGGTTGTCAGCTCGAGCTGACAACCTACAGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159522.1-640s21c1
Sequence:CCGGTTGGGTTGTGCTCAATCTTCACTCGAGTGAAGATTGAGCACAACCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159522.1-759s21c1
Sequence:CCGGCATACTGCAGATAGAAGTTACCTCGAGGTAACTTCTATCTGCAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001159522
ZNF727 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 727
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159522.1-974s21c1
Sequence:CCGGTAGGTGTTGCTCAGACCTTACCTCGAGGTAAGGTCTGAGCAACACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159522.1-434s21c1
Sequence:CCGGATTGCTGGAGCACGACATAAACTCGAGTTTATGTCGTGCTCCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159522.1-715s21c1
Sequence:CCGGGCAAAGACTGTAGGTTGTCAGCTCGAGCTGACAACCTACAGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159522.1-640s21c1
Sequence:CCGGTTGGGTTGTGCTCAATCTTCACTCGAGTGAAGATTGAGCACAACCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159522.1-759s21c1
Sequence:CCGGCATACTGCAGATAGAAGTTACCTCGAGGTAACTTCTATCTGCAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001159522
ZNF727 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 727
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159522.1-974s21c1
Sequence:CCGGTAGGTGTTGCTCAGACCTTACCTCGAGGTAAGGTCTGAGCAACACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159522.1-434s21c1
Sequence:CCGGATTGCTGGAGCACGACATAAACTCGAGTTTATGTCGTGCTCCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159522.1-715s21c1
Sequence:CCGGGCAAAGACTGTAGGTTGTCAGCTCGAGCTGACAACCTACAGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159522.1-640s21c1
Sequence:CCGGTTGGGTTGTGCTCAATCTTCACTCGAGTGAAGATTGAGCACAACCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159522.1-759s21c1
Sequence:CCGGCATACTGCAGATAGAAGTTACCTCGAGGTAACTTCTATCTGCAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks