EMAIL THIS PAGE TO A FRIEND

ZNF732

zinc finger protein 732

Species: Human ZNF732(654254)
UniProtKB ID: B4DXR9
Gene ID:
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001137608 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001137608 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001137608 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_036877 Rosetta Predictions human pricing
XR_037067 Rosetta Predictions human pricing
XR_037305 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_036877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00498859 predicted 864
2 SASI_Hs02_00498860 predicted 1964
3 SASI_Hs02_00498861 predicted 1885
4 SASI_Hs02_00498862 predicted 2085
5 SASI_Hs02_00498863 predicted 1191
6 SASI_Hs02_00498864 predicted 622
7 SASI_Hs02_00498865 predicted 436
8 SASI_Hs02_00498866 predicted 472
9 SASI_Hs02_00498867 predicted 2133
10 SASI_Hs02_00498868 predicted 1538
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_037067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00499792 predicted 872
2 SASI_Hs02_00499793 predicted 1965
3 SASI_Hs02_00499794 predicted 1885
4 SASI_Hs02_00499795 predicted 2081
5 SASI_Hs02_00499796 predicted 1194
6 SASI_Hs02_00499797 predicted 625
7 SASI_Hs02_00499798 predicted 442
8 SASI_Hs02_00499799 predicted 469
9 SASI_Hs02_00499800 predicted 2137
10 SASI_Hs02_00499801 predicted 1540
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_037305 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00500954 predicted 871
2 SASI_Hs02_00500955 predicted 1962
3 SASI_Hs02_00500956 predicted 1886
4 SASI_Hs02_00500957 predicted 2079
5 SASI_Hs02_00500958 predicted 1191
6 SASI_Hs02_00500959 predicted 622
7 SASI_Hs02_00500960 predicted 442
8 SASI_Hs02_00500961 predicted 469
9 SASI_Hs02_00500962 predicted 2133
10 SASI_Hs02_00500963 predicted 1537
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001137608
ZNF732 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 732
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137608.1-1630s21c1
Sequence:CCGGGACGTTCCAGAGTCCTGAATACTCGAGTATTCAGGACTCTGGAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137608.1-291s21c1
Sequence:CCGGTCGTTCCACAAACTTATATTACTCGAGTAATATAAGTTTGTGGAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137608.1-1210s21c1
Sequence:CCGGGTCGGTTCACAACCCTTAATGCTCGAGCATTAAGGGTTGTGAACCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137608.1-1295s21c1
Sequence:CCGGATGGTCCACAGACCTGAATAACTCGAGTTATTCAGGTCTGTGGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001137608.1-1971s21c1
Sequence:CCGGCGCATACCTGAATCAACATAACTCGAGTTATGTTGATTCAGGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001137608
ZNF732 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 732
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137608.1-1630s21c1
Sequence:CCGGGACGTTCCAGAGTCCTGAATACTCGAGTATTCAGGACTCTGGAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137608.1-291s21c1
Sequence:CCGGTCGTTCCACAAACTTATATTACTCGAGTAATATAAGTTTGTGGAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137608.1-1210s21c1
Sequence:CCGGGTCGGTTCACAACCCTTAATGCTCGAGCATTAAGGGTTGTGAACCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137608.1-1295s21c1
Sequence:CCGGATGGTCCACAGACCTGAATAACTCGAGTTATTCAGGTCTGTGGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001137608.1-1971s21c1
Sequence:CCGGCGCATACCTGAATCAACATAACTCGAGTTATGTTGATTCAGGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001137608
ZNF732 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 732
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137608.1-1630s21c1
Sequence:CCGGGACGTTCCAGAGTCCTGAATACTCGAGTATTCAGGACTCTGGAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137608.1-291s21c1
Sequence:CCGGTCGTTCCACAAACTTATATTACTCGAGTAATATAAGTTTGTGGAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137608.1-1210s21c1
Sequence:CCGGGTCGGTTCACAACCCTTAATGCTCGAGCATTAAGGGTTGTGAACCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137608.1-1295s21c1
Sequence:CCGGATGGTCCACAGACCTGAATAACTCGAGTTATTCAGGTCTGTGGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001137608.1-1971s21c1
Sequence:CCGGCGCATACCTGAATCAACATAACTCGAGTTATGTTGATTCAGGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks