EMAIL THIS PAGE TO A FRIEND

ZNF735

zinc finger protein 735

Species: Human ZNF735(730291)
UniProtKB ID: P0CB33
Gene ID:
12 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001159524 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001159524 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001159524 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714410 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00396912 predicted 1634
2 SASI_Hs02_00396913 predicted 598
3 SASI_Hs02_00396914 predicted 2922
4 SASI_Hs02_00396915 predicted 601
5 SASI_Hs02_00396916 predicted 782
6 SASI_Hs02_00396917 predicted 549
7 SASI_Hs02_00396918 predicted 2931
8 SASI_Hs02_00396919 predicted 1871
9 SASI_Hs02_00396920 predicted 776
10 SASI_Hs02_00396921 predicted 1633
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001159524
ZNF735 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 735
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159524.1-1009s21c1
Sequence:CCGGTCCTCGACTCTTAAGACACATCTCGAGATGTGTCTTAAGAGTCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159524.1-155s21c1
Sequence:CCGGTGTTCTCCCTGGGTATGACTGCTCGAGCAGTCATACCCAGGGAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159524.1-519s21c1
Sequence:CCGGTAGACACAATGCAAGATATACCTCGAGGTATATCTTGCATTGTGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159524.1-921s21c1
Sequence:CCGGCGTATCCTCAGCCCTCATTTACTCGAGTAAATGAGGGCTGAGGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159524.1-668s21c1
Sequence:CCGGACCACTCCTCAAGCGGTACTACTCGAGTAGTACCGCTTGAGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001159524
ZNF735 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 735
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159524.1-1009s21c1
Sequence:CCGGTCCTCGACTCTTAAGACACATCTCGAGATGTGTCTTAAGAGTCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159524.1-155s21c1
Sequence:CCGGTGTTCTCCCTGGGTATGACTGCTCGAGCAGTCATACCCAGGGAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159524.1-519s21c1
Sequence:CCGGTAGACACAATGCAAGATATACCTCGAGGTATATCTTGCATTGTGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159524.1-921s21c1
Sequence:CCGGCGTATCCTCAGCCCTCATTTACTCGAGTAAATGAGGGCTGAGGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159524.1-668s21c1
Sequence:CCGGACCACTCCTCAAGCGGTACTACTCGAGTAGTACCGCTTGAGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001159524
ZNF735 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 735
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159524.1-1009s21c1
Sequence:CCGGTCCTCGACTCTTAAGACACATCTCGAGATGTGTCTTAAGAGTCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159524.1-155s21c1
Sequence:CCGGTGTTCTCCCTGGGTATGACTGCTCGAGCAGTCATACCCAGGGAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159524.1-519s21c1
Sequence:CCGGTAGACACAATGCAAGATATACCTCGAGGTATATCTTGCATTGTGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159524.1-921s21c1
Sequence:CCGGCGTATCCTCAGCCCTCATTTACTCGAGTAAATGAGGGCTGAGGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159524.1-668s21c1
Sequence:CCGGACCACTCCTCAAGCGGTACTACTCGAGTAGTACCGCTTGAGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks