EMAIL THIS PAGE TO A FRIEND

ZNF737

zinc finger protein 737

Synonyms: ZNF102
Species: Human ZNF737(100129842)
UniProtKB ID: O75373, C9JHM3
Gene ID:
27 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305908 ANTI-ZNF737(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001159293 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001159293 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001159293 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_039620 Rosetta Predictions human pricing
XR_042310 Rosetta Predictions human pricing
XR_042491 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00512159 predicted 394
2 SASI_Hs02_00512160 predicted 1063
3 SASI_Hs02_00512161 predicted 1645
4 SASI_Hs02_00512162 predicted 1212
5 SASI_Hs02_00512163 predicted 1056
6 SASI_Hs02_00512164 predicted 1648
7 SASI_Hs02_00512165 predicted 1617
8 SASI_Hs02_00512166 predicted 1796
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042310 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00533831 predicted 386
2 SASI_Hs02_00533832 predicted 1055
3 SASI_Hs02_00533833 predicted 1644
4 SASI_Hs02_00533834 predicted 1214
5 SASI_Hs02_00533835 predicted 1058
6 SASI_Hs02_00533836 predicted 1648
7 SASI_Hs02_00533837 predicted 1616
8 SASI_Hs02_00533838 predicted 1796
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00534813 predicted 393
2 SASI_Hs02_00534814 predicted 1055
3 SASI_Hs02_00534815 predicted 1640
4 SASI_Hs02_00534816 predicted 1216
5 SASI_Hs02_00534817 predicted 1062
6 SASI_Hs02_00534818 predicted 1645
7 SASI_Hs02_00534819 predicted 1622
8 SASI_Hs02_00534820 predicted 1801
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001159293
ZNF737 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 737
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159293.1-1103s21c1
Sequence:CCGGGCGGAGAGAAACCCTACAAATCTCGAGATTTGTAGGGTTTCTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159293.1-908s21c1
Sequence:CCGGACCTTACTGCACATAAGATAACTCGAGTTATCTTATGTGCAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159293.1-1074s21c1
Sequence:CCGGTATCCTTACTGCGCATAAGATCTCGAGATCTTATGCGCAGTAAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159293.1-244s21c1
Sequence:CCGGGACACTGCACAGCGGAATTTACTCGAGTAAATTCCGCTGTGCAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001159293.1-1997s21c1
Sequence:CCGGCCCTTACTAGACATAAGATAACTCGAGTTATCTTATGTCTAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001159293
ZNF737 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 737
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159293.1-1103s21c1
Sequence:CCGGGCGGAGAGAAACCCTACAAATCTCGAGATTTGTAGGGTTTCTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159293.1-908s21c1
Sequence:CCGGACCTTACTGCACATAAGATAACTCGAGTTATCTTATGTGCAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159293.1-1074s21c1
Sequence:CCGGTATCCTTACTGCGCATAAGATCTCGAGATCTTATGCGCAGTAAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159293.1-244s21c1
Sequence:CCGGGACACTGCACAGCGGAATTTACTCGAGTAAATTCCGCTGTGCAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001159293.1-1997s21c1
Sequence:CCGGCCCTTACTAGACATAAGATAACTCGAGTTATCTTATGTCTAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001159293
ZNF737 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 737
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159293.1-1103s21c1
Sequence:CCGGGCGGAGAGAAACCCTACAAATCTCGAGATTTGTAGGGTTTCTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159293.1-908s21c1
Sequence:CCGGACCTTACTGCACATAAGATAACTCGAGTTATCTTATGTGCAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159293.1-1074s21c1
Sequence:CCGGTATCCTTACTGCGCATAAGATCTCGAGATCTTATGCGCAGTAAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159293.1-244s21c1
Sequence:CCGGGACACTGCACAGCGGAATTTACTCGAGTAAATTCCGCTGTGCAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001159293.1-1997s21c1
Sequence:CCGGCCCTTACTAGACATAAGATAACTCGAGTTATCTTATGTCTAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks