EMAIL THIS PAGE TO A FRIEND

ZNF740

zinc finger protein 740

Synonyms: Zfp740
UniProtKB ID: Q8NDX6, A8K9M9
Gene ID:
Rat(685834) zinc finger protein 740
domestic guinea pig(100727883) zinc finger protein 740
naked mole-rat(101720444) zinc finger protein 740
cow(516327) zinc finger protein 740
Goat(100861109) zinc finger protein 740
sheep(101106924) zinc finger protein 740
Zebrafish(767693) zinc finger protein 740
dog(486509) zinc finger protein 740
domestic cat(101083015) zinc finger protein 740
chicken(100859343) zinc finger protein 740
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004304 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004304 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004304 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU034871 MISSION® esiRNA esiRNA human ZNF740 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004304 Rosetta Predictions human pricing
XM_001065442 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004304 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145423 predicted 1405
2 SASI_Hs01_00145424 predicted 1247
3 SASI_Hs01_00145426 predicted 1127
4 SASI_Hs01_00145427 predicted 536
5 SASI_Hs01_00145428 predicted 771
6 SASI_Hs01_00145429 predicted 790
7 SASI_Hs01_00145430 predicted 1397
8 SASI_Hs01_00145431 predicted 778
9 SASI_Hs01_00145432 predicted 1251
10 SASI_Hs02_00304504 predicted 819
11 SASI_Hs01_00145425 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065442 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314137 predicted 910
2 SASI_Rn02_00314138 predicted 916
3 SASI_Rn02_00314139 predicted 779
4 SASI_Rn02_00314140 predicted 906
5 SASI_Rn02_00314141 predicted 903
6 SASI_Rn02_00314142 predicted 756
7 SASI_Rn02_00314143 predicted 908
8 SASI_Rn02_00314144 predicted 940
9 SASI_Rn02_00314145 predicted 903
10 SASI_Rn02_00314146 predicted 888
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004304
ZNF740 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 740
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000107530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004304.2-1960s1c1
Sequence:CCGGGCTGCTCAAGAAACAAAGGAACTCGAGTTCCTTTGTTTCTTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004304.2-789s1c1
Sequence:CCGGGCGATATATGTGATATGCGTTCTCGAGAACGCATATCACATATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004304.2-727s1c1
Sequence:CCGGTCGGAGCAGTTACCACCTAAACTCGAGTTTAGGTGGTAACTGCTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004304.2-905s1c1
Sequence:CCGGGATCGATTACTCAGACACAAACTCGAGTTTGTGTCTGAGTAATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004304
ZNF740 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 740
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000107530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004304.2-1960s1c1
Sequence:CCGGGCTGCTCAAGAAACAAAGGAACTCGAGTTCCTTTGTTTCTTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004304.2-789s1c1
Sequence:CCGGGCGATATATGTGATATGCGTTCTCGAGAACGCATATCACATATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004304.2-727s1c1
Sequence:CCGGTCGGAGCAGTTACCACCTAAACTCGAGTTTAGGTGGTAACTGCTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004304.2-905s1c1
Sequence:CCGGGATCGATTACTCAGACACAAACTCGAGTTTGTGTCTGAGTAATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004304
ZNF740 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 740
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000107530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004304.2-1960s1c1
Sequence:CCGGGCTGCTCAAGAAACAAAGGAACTCGAGTTCCTTTGTTTCTTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004304.2-789s1c1
Sequence:CCGGGCGATATATGTGATATGCGTTCTCGAGAACGCATATCACATATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004304.2-727s1c1
Sequence:CCGGTCGGAGCAGTTACCACCTAAACTCGAGTTTAGGTGGTAACTGCTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004304.2-905s1c1
Sequence:CCGGGATCGATTACTCAGACACAAACTCGAGTTTGTGTCTGAGTAATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks