EMAIL THIS PAGE TO A FRIEND

ZNF746

zinc finger protein 746

Synonyms: PARIS
UniProtKB ID: Q6NUN9, A8K6Z9, Q6ZRF9
Gene ID:
domestic cat(101092097) zinc finger protein 746
dog(610814) zinc finger protein 746
cow(521998) zinc finger protein 746
sheep(101108126) zinc finger protein 746
naked mole-rat(101720729) zinc finger protein 746
Domestic Rabbit(100352248) zinc finger protein 746
domestic guinea pig(100729565) zinc finger protein 746
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152557 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152557 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152557 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152557 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152557 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168649 predicted 981
2 SASI_Hs01_00168650 predicted 711
3 SASI_Hs01_00168651 predicted 2027
4 SASI_Hs01_00168652 predicted 941
5 SASI_Hs01_00168653 predicted 1059
6 SASI_Hs01_00168654 predicted 1209
7 SASI_Hs01_00168655 predicted 2045
8 SASI_Hs01_00168656 predicted 2017
9 SASI_Hs01_00168657 predicted 1084
10 SASI_Hs02_00366372 predicted 1891
11 SASI_Hs01_00168658 predicted 2052
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152557
ZNF746 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 746
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154566    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152557.3-3367s1c1
Sequence:CCGGGCTTGTTCATTCCAGCATCTACTCGAGTAGATGCTGGAATGAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152557.3-875s1c1
Sequence:CCGGCTCTGGTGTCCATTCCAACTTCTCGAGAAGTTGGAATGGACACCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152557.3-1424s1c1
Sequence:CCGGGCCATTCAACGAACCCTGTAACTCGAGTTACAGGGTTCGTTGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152557.3-1061s1c1
Sequence:CCGGCGTACATCCTACTGACCTAGACTCGAGTCTAGGTCAGTAGGATGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152557.3-225s1c1
Sequence:CCGGGCCATGGAGAGGAAGATTGAACTCGAGTTCAATCTTCCTCTCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156627    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152557.3-3257s1c1
Sequence:CCGGGCCTCAAAGGAACTTCTGCTTCTCGAGAAGCAGAAGTTCCTTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152557.3-1306s1c1
Sequence:CCGGGCTGGAATTTCCGGTGTAAACCTCGAGGTTTACACCGGAAATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152557.4-2404s21c1
Sequence:CCGGGAAATGGGAGCGCCGTAGAATCTCGAGATTCTACGGCGCTCCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152557.4-945s21c1
Sequence:CCGGATTCCGGAGCAGGAGACATCTCTCGAGAGATGTCTCCTGCTCCGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152557
ZNF746 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 746
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154566    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152557.3-3367s1c1
Sequence:CCGGGCTTGTTCATTCCAGCATCTACTCGAGTAGATGCTGGAATGAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152557.3-875s1c1
Sequence:CCGGCTCTGGTGTCCATTCCAACTTCTCGAGAAGTTGGAATGGACACCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152557.3-1424s1c1
Sequence:CCGGGCCATTCAACGAACCCTGTAACTCGAGTTACAGGGTTCGTTGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152557.3-1061s1c1
Sequence:CCGGCGTACATCCTACTGACCTAGACTCGAGTCTAGGTCAGTAGGATGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152557.3-225s1c1
Sequence:CCGGGCCATGGAGAGGAAGATTGAACTCGAGTTCAATCTTCCTCTCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156627    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152557.3-3257s1c1
Sequence:CCGGGCCTCAAAGGAACTTCTGCTTCTCGAGAAGCAGAAGTTCCTTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152557.3-1306s1c1
Sequence:CCGGGCTGGAATTTCCGGTGTAAACCTCGAGGTTTACACCGGAAATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152557.4-2404s21c1
Sequence:CCGGGAAATGGGAGCGCCGTAGAATCTCGAGATTCTACGGCGCTCCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152557.4-945s21c1
Sequence:CCGGATTCCGGAGCAGGAGACATCTCTCGAGAGATGTCTCCTGCTCCGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152557
ZNF746 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 746
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154566    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152557.3-3367s1c1
Sequence:CCGGGCTTGTTCATTCCAGCATCTACTCGAGTAGATGCTGGAATGAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152557.3-875s1c1
Sequence:CCGGCTCTGGTGTCCATTCCAACTTCTCGAGAAGTTGGAATGGACACCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152557.3-1424s1c1
Sequence:CCGGGCCATTCAACGAACCCTGTAACTCGAGTTACAGGGTTCGTTGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152557.3-1061s1c1
Sequence:CCGGCGTACATCCTACTGACCTAGACTCGAGTCTAGGTCAGTAGGATGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152557.3-225s1c1
Sequence:CCGGGCCATGGAGAGGAAGATTGAACTCGAGTTCAATCTTCCTCTCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156627    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152557.3-3257s1c1
Sequence:CCGGGCCTCAAAGGAACTTCTGCTTCTCGAGAAGCAGAAGTTCCTTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152557.3-1306s1c1
Sequence:CCGGGCTGGAATTTCCGGTGTAAACCTCGAGGTTTACACCGGAAATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152557.4-2404s21c1
Sequence:CCGGGAAATGGGAGCGCCGTAGAATCTCGAGATTCTACGGCGCTCCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152557.4-945s21c1
Sequence:CCGGATTCCGGAGCAGGAGACATCTCTCGAGAGATGTCTCCTGCTCCGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks