EMAIL THIS PAGE TO A FRIEND

ZNF747

zinc finger protein 747

Species: Human ZNF747(65988)
UniProtKB ID: Q9BV97, A8K827, B7WNU3, Q59FB4, Q96NW0
Gene ID:
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023931 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023931 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023931 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052381 MISSION® esiRNA esiRNA human ZNF747 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023931 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023931 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213798 predicted 912
2 SASI_Hs01_00213799 predicted 564
3 SASI_Hs01_00213802 predicted 918
4 SASI_Hs01_00213800 predicted 684
5 SASI_Hs01_00213803 predicted 680
6 SASI_Hs01_00213801 predicted 1086
7 SASI_Hs01_00213805 predicted 1303
8 SASI_Hs01_00213806 predicted 1596
9 SASI_Hs02_00356395 predicted 1344
10 SASI_Hs02_00356396 predicted 1976
11 SASI_Hs01_00213804 predicted 1566
12 SASI_Hs01_00213807 predicted 1569
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023931
ZNF747 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 747
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023931.2-647s1c1
Sequence:CCGGGTGGCGAAGTGTCCGACAGAACTCGAGTTCTGTCGGACACTTCGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023931.2-656s1c1
Sequence:CCGGTGTCCGACAGAAGCGGACCCACTCGAGTGGGTCCGCTTCTGTCGGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023931.2-477s1c1
Sequence:CCGGCCTCTGGGAGCTGCGTGTGGACTCGAGTCCACACGCAGCTCCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023931.2-684s1c1
Sequence:CCGGCCAGAAACAAGGAAGAGGAAACTCGAGTTTCCTCTTCCTTGTTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023931.2-695s1c1
Sequence:CCGGGAAGAGGAAAGACAAAGGGAACTCGAGTTCCCTTTGTCTTTCCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023931
ZNF747 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 747
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023931.2-647s1c1
Sequence:CCGGGTGGCGAAGTGTCCGACAGAACTCGAGTTCTGTCGGACACTTCGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023931.2-656s1c1
Sequence:CCGGTGTCCGACAGAAGCGGACCCACTCGAGTGGGTCCGCTTCTGTCGGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023931.2-477s1c1
Sequence:CCGGCCTCTGGGAGCTGCGTGTGGACTCGAGTCCACACGCAGCTCCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023931.2-684s1c1
Sequence:CCGGCCAGAAACAAGGAAGAGGAAACTCGAGTTTCCTCTTCCTTGTTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023931.2-695s1c1
Sequence:CCGGGAAGAGGAAAGACAAAGGGAACTCGAGTTCCCTTTGTCTTTCCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023931
ZNF747 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 747
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023931.2-647s1c1
Sequence:CCGGGTGGCGAAGTGTCCGACAGAACTCGAGTTCTGTCGGACACTTCGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023931.2-656s1c1
Sequence:CCGGTGTCCGACAGAAGCGGACCCACTCGAGTGGGTCCGCTTCTGTCGGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023931.2-477s1c1
Sequence:CCGGCCTCTGGGAGCTGCGTGTGGACTCGAGTCCACACGCAGCTCCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023931.2-684s1c1
Sequence:CCGGCCAGAAACAAGGAAGAGGAAACTCGAGTTTCCTCTTCCTTGTTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023931.2-695s1c1
Sequence:CCGGGAAGAGGAAAGACAAAGGGAACTCGAGTTCCCTTTGTCTTTCCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks