EMAIL THIS PAGE TO A FRIEND

ZNF749

zinc finger protein 749

Species: Human ZNF749(388567)
UniProtKB ID: O43361
Gene ID:
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001023561 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001023561 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001023561 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU117421 MISSION® esiRNA esiRNA human ZNF749 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001023561 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001023561 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094614 predicted 1468
2 SASI_Hs01_00094615 predicted 1106
3 SASI_Hs01_00094616 predicted 2367
4 SASI_Hs01_00094619 predicted 2344
5 SASI_Hs01_00094620 predicted 2196
6 SASI_Hs02_00307081 predicted 807
7 SASI_Hs02_00307082 predicted 1740
8 SASI_Hs02_00307083 predicted 2355
9 SASI_Hs02_00307084 predicted 442
10 SASI_Hs01_00094617 predicted 456
11 SASI_Hs01_00094618 predicted 1431
12 SASI_Hs01_00094621 predicted 514
13 SASI_Hs01_00094622 predicted 1775
14 SASI_Hs01_00094623 predicted 255
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001023561
VALIDATED
ZNF749 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 749
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023561.1-1777s1c1
Sequence:CCGGCGCTCTACATTCATTAAACATCTCGAGATGTTTAATGAATGTAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001023561.1-1146s1c1
Sequence:CCGGCCTCATTCAACACAAGAGGATCTCGAGATCCTCTTGTGTTGAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023561.1-1522s1c1
Sequence:CCGGGACAGCTACAAACTTGTTATTCTCGAGAATAACAAGTTTGTAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023561.1-617s1c1
Sequence:CCGGGTAGACCAACACCTTATGAATCTCGAGATTCATAAGGTGTTGGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023561.1-1830s1c1
Sequence:CCGGGTGCAGTAAATGTAGGGAATTCTCGAGAATTCCCTACATTTACTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001023561.2-1431s21c1
Sequence:CCGGCACCGCTCCACACTCAATATGCTCGAGCATATTGAGTGTGGAGCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001023561.2-2359s21c1
Sequence:CCGGGGGAATTGTTTAGGACTAAATCTCGAGATTTAGTCCTAAACAATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001023561.2-2288s21c1
Sequence:GTACCGGATACCGCTCTACATTCATTAACTCGAGTTAATGAATGTAGAGCGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001023561.2-2515s21c1
Sequence:GTACCGGGTGAATCCAGCAAAGTGTTTACTCGAGTAAACACTTTGCTGGATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001023561.2-2651s21c1
Sequence:CCGGATCGGACCAAGAACCTATTAACTCGAGTTAATAGGTTCTTGGTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001023561
VALIDATED
ZNF749 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 749
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023561.1-1777s1c1
Sequence:CCGGCGCTCTACATTCATTAAACATCTCGAGATGTTTAATGAATGTAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001023561.1-1146s1c1
Sequence:CCGGCCTCATTCAACACAAGAGGATCTCGAGATCCTCTTGTGTTGAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023561.1-1522s1c1
Sequence:CCGGGACAGCTACAAACTTGTTATTCTCGAGAATAACAAGTTTGTAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023561.1-617s1c1
Sequence:CCGGGTAGACCAACACCTTATGAATCTCGAGATTCATAAGGTGTTGGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023561.1-1830s1c1
Sequence:CCGGGTGCAGTAAATGTAGGGAATTCTCGAGAATTCCCTACATTTACTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001023561.2-1431s21c1
Sequence:CCGGCACCGCTCCACACTCAATATGCTCGAGCATATTGAGTGTGGAGCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001023561.2-2359s21c1
Sequence:CCGGGGGAATTGTTTAGGACTAAATCTCGAGATTTAGTCCTAAACAATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001023561.2-2288s21c1
Sequence:GTACCGGATACCGCTCTACATTCATTAACTCGAGTTAATGAATGTAGAGCGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001023561.2-2515s21c1
Sequence:GTACCGGGTGAATCCAGCAAAGTGTTTACTCGAGTAAACACTTTGCTGGATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001023561.2-2651s21c1
Sequence:CCGGATCGGACCAAGAACCTATTAACTCGAGTTAATAGGTTCTTGGTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001023561
VALIDATED
ZNF749 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 749
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023561.1-1777s1c1
Sequence:CCGGCGCTCTACATTCATTAAACATCTCGAGATGTTTAATGAATGTAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001023561.1-1146s1c1
Sequence:CCGGCCTCATTCAACACAAGAGGATCTCGAGATCCTCTTGTGTTGAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023561.1-1522s1c1
Sequence:CCGGGACAGCTACAAACTTGTTATTCTCGAGAATAACAAGTTTGTAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023561.1-617s1c1
Sequence:CCGGGTAGACCAACACCTTATGAATCTCGAGATTCATAAGGTGTTGGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023561.1-1830s1c1
Sequence:CCGGGTGCAGTAAATGTAGGGAATTCTCGAGAATTCCCTACATTTACTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001023561.2-1431s21c1
Sequence:CCGGCACCGCTCCACACTCAATATGCTCGAGCATATTGAGTGTGGAGCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001023561.2-2359s21c1
Sequence:CCGGGGGAATTGTTTAGGACTAAATCTCGAGATTTAGTCCTAAACAATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001023561.2-2288s21c1
Sequence:GTACCGGATACCGCTCTACATTCATTAACTCGAGTTAATGAATGTAGAGCGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001023561.2-2515s21c1
Sequence:GTACCGGGTGAATCCAGCAAAGTGTTTACTCGAGTAAACACTTTGCTGGATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001023561.2-2651s21c1
Sequence:CCGGATCGGACCAAGAACCTATTAACTCGAGTTAATAGGTTCTTGGTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks