EMAIL THIS PAGE TO A FRIEND

ZNF74

zinc finger protein 74

Synonyms: COS52 ZFP520 ZNF520 hZNF7
Gene ID:
domestic cat(101082523) zinc finger protein 74
Horse(100051226) zinc finger protein 74
dog(100684862) zinc finger protein 74
cow(509706) zinc finger protein 74
naked mole-rat(101726668) zinc finger protein 74
Domestic Rabbit(100350965) zinc finger protein 74
domestic guinea pig(100734111) zinc finger protein 74
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003426 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003426 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003426 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078851 MISSION® esiRNA esiRNA human ZNF74 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003426 Rosetta Predictions human pricing
NR_003253 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172283 predicted 1785
2 SASI_Hs02_00335634 predicted 553
3 SASI_Hs01_00172284 predicted 1675
4 SASI_Hs01_00172285 predicted 1370
5 SASI_Hs02_00335635 predicted 1869
6 SASI_Hs02_00335636 predicted 486
7 SASI_Hs02_00335637 predicted 498
8 SASI_Hs01_00172288 predicted 1541
9 SASI_Hs01_00172289 predicted 802
10 SASI_Hs01_00172286 predicted 2300
11 SASI_Hs01_00172287 predicted 2525
12 SASI_Hs01_00172290 predicted 1376
13 SASI_Hs01_00172291 predicted 2472
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003253 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378918 predicted 1705
2 SASI_Hs02_00378919 predicted 1588
3 SASI_Hs02_00378920 predicted 1279
4 SASI_Hs02_00378921 predicted 1782
5 SASI_Hs02_00378922 predicted 460
6 SASI_Hs02_00378923 predicted 3386
7 SASI_Hs02_00378924 predicted 3469
8 SASI_Hs02_00378925 predicted 1447
9 SASI_Hs02_00378926 predicted 710
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003426
VALIDATED
ZNF74 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 74
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-554s21c1
Sequence:CCGGTCCAAGGAATCGGTGAGTTTCCTCGAGGAAACTCACCGATTCCTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-1028s21c1
Sequence:CCGGTTGCTGGACACACGCAAGAACCTCGAGGTTCTTGCGTGTGTCCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-1642s21c1
Sequence:CCGGATCCCTCACCGTGCATGAGAACTCGAGTTCTCATGCACGGTGAGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-1258s21c1
Sequence:CCGGGAAGGCTTACAAGTGCGATGACTCGAGTCATCGCACTTGTAAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-2187s21c1
Sequence:CCGGCCTTGGCCATCCAGTTCAACACTCGAGTGTTGAACTGGATGGCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-661s21c1
Sequence:CCGGGAACTACCAGAACCTTCTTGCCTCGAGGCAAGAAGGTTCTGGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003426.2-2617s21c1
Sequence:CCGGTTGATGGGCCTGGAAGTTGTTCTCGAGAACAACTTCCAGGCCCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-2362s21c1
Sequence:CCGGACCTCGAAACTAACATGATGTCTCGAGACATCATGTTAGTTTCGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003426.2-2517s21c1
Sequence:CCGGAGGGTGCCTCCTCTAGTTAAACTCGAGTTTAACTAGAGGAGGCACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-2054s21c1
Sequence:CCGGCAGAACCACTGTCTCATTAAACTCGAGTTTAATGAGACAGTGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-2304s21c1
Sequence:CCGGCAAAGCTCTTGTGCGTGGTTCCTCGAGGAACCACGCACAAGAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_003426.1-3071s1c1
Sequence:CCGGGCTGCTTTCTGAGCTACTCAACTCGAGTTGAGTAGCTCAGAAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_003426.1-2771s1c1
Sequence:CCGGGAAGTCGTTTAAGTGTGAGAACTCGAGTTCTCACACTTAAACGACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003426.1-1365s1c1
Sequence:CCGGCCTCCACTGCACAAGCCAGATCTCGAGATCTGGCTTGTGCAGTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_003426.1-2882s1c1
Sequence:CCGGACACCTGCTCAGCACATACTACTCGAGTAGTATGTGCTGAGCAGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003426.1-1479s1c1
Sequence:CCGGCCCTCTCAACAGCAGGGCATTCTCGAGAATGCCCTGCTGTTGAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003426
VALIDATED
ZNF74 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 74
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-554s21c1
Sequence:CCGGTCCAAGGAATCGGTGAGTTTCCTCGAGGAAACTCACCGATTCCTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-1028s21c1
Sequence:CCGGTTGCTGGACACACGCAAGAACCTCGAGGTTCTTGCGTGTGTCCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-1642s21c1
Sequence:CCGGATCCCTCACCGTGCATGAGAACTCGAGTTCTCATGCACGGTGAGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-1258s21c1
Sequence:CCGGGAAGGCTTACAAGTGCGATGACTCGAGTCATCGCACTTGTAAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-2187s21c1
Sequence:CCGGCCTTGGCCATCCAGTTCAACACTCGAGTGTTGAACTGGATGGCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-661s21c1
Sequence:CCGGGAACTACCAGAACCTTCTTGCCTCGAGGCAAGAAGGTTCTGGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003426.2-2617s21c1
Sequence:CCGGTTGATGGGCCTGGAAGTTGTTCTCGAGAACAACTTCCAGGCCCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-2362s21c1
Sequence:CCGGACCTCGAAACTAACATGATGTCTCGAGACATCATGTTAGTTTCGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003426.2-2517s21c1
Sequence:CCGGAGGGTGCCTCCTCTAGTTAAACTCGAGTTTAACTAGAGGAGGCACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-2054s21c1
Sequence:CCGGCAGAACCACTGTCTCATTAAACTCGAGTTTAATGAGACAGTGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-2304s21c1
Sequence:CCGGCAAAGCTCTTGTGCGTGGTTCCTCGAGGAACCACGCACAAGAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_003426.1-3071s1c1
Sequence:CCGGGCTGCTTTCTGAGCTACTCAACTCGAGTTGAGTAGCTCAGAAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_003426.1-2771s1c1
Sequence:CCGGGAAGTCGTTTAAGTGTGAGAACTCGAGTTCTCACACTTAAACGACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003426.1-1365s1c1
Sequence:CCGGCCTCCACTGCACAAGCCAGATCTCGAGATCTGGCTTGTGCAGTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_003426.1-2882s1c1
Sequence:CCGGACACCTGCTCAGCACATACTACTCGAGTAGTATGTGCTGAGCAGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003426.1-1479s1c1
Sequence:CCGGCCCTCTCAACAGCAGGGCATTCTCGAGAATGCCCTGCTGTTGAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003426
VALIDATED
ZNF74 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 74
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-554s21c1
Sequence:CCGGTCCAAGGAATCGGTGAGTTTCCTCGAGGAAACTCACCGATTCCTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-1028s21c1
Sequence:CCGGTTGCTGGACACACGCAAGAACCTCGAGGTTCTTGCGTGTGTCCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-1642s21c1
Sequence:CCGGATCCCTCACCGTGCATGAGAACTCGAGTTCTCATGCACGGTGAGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-1258s21c1
Sequence:CCGGGAAGGCTTACAAGTGCGATGACTCGAGTCATCGCACTTGTAAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-2187s21c1
Sequence:CCGGCCTTGGCCATCCAGTTCAACACTCGAGTGTTGAACTGGATGGCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-661s21c1
Sequence:CCGGGAACTACCAGAACCTTCTTGCCTCGAGGCAAGAAGGTTCTGGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003426.2-2617s21c1
Sequence:CCGGTTGATGGGCCTGGAAGTTGTTCTCGAGAACAACTTCCAGGCCCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-2362s21c1
Sequence:CCGGACCTCGAAACTAACATGATGTCTCGAGACATCATGTTAGTTTCGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003426.2-2517s21c1
Sequence:CCGGAGGGTGCCTCCTCTAGTTAAACTCGAGTTTAACTAGAGGAGGCACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-2054s21c1
Sequence:CCGGCAGAACCACTGTCTCATTAAACTCGAGTTTAATGAGACAGTGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003426.2-2304s21c1
Sequence:CCGGCAAAGCTCTTGTGCGTGGTTCCTCGAGGAACCACGCACAAGAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_003426.1-3071s1c1
Sequence:CCGGGCTGCTTTCTGAGCTACTCAACTCGAGTTGAGTAGCTCAGAAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_003426.1-2771s1c1
Sequence:CCGGGAAGTCGTTTAAGTGTGAGAACTCGAGTTCTCACACTTAAACGACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003426.1-1365s1c1
Sequence:CCGGCCTCCACTGCACAAGCCAGATCTCGAGATCTGGCTTGTGCAGTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_003426.1-2882s1c1
Sequence:CCGGACACCTGCTCAGCACATACTACTCGAGTAGTATGTGCTGAGCAGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003426.1-1479s1c1
Sequence:CCGGCCCTCTCAACAGCAGGGCATTCTCGAGAATGCCCTGCTGTTGAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks