EMAIL THIS PAGE TO A FRIEND

ZNF750

zinc finger protein 750

Synonyms: ZFP750
UniProtKB ID: Q32MQ0, Q9H899
Gene ID:
Human(79755) Summary: This gene encodes a protein with a nuclear localization site and a C2H2 zinc finger domain. Mutations in this gene have been associated with seborrhea-like dermatitis with psoriasiform elements. [provided by RefSeq, Jul 2008]
Zebrafish(550483) zinc finger protein 750
chicken(101665408) zinc finger protein 750
chicken(101750712) zinc finger protein 750
domestic cat(101093475) zinc finger protein 750
Horse(100056069) zinc finger protein 750
dog(608362) zinc finger protein 750
domestic guinea pig(100718371) zinc finger protein 750
naked mole-rat(101710518) zinc finger protein 750
cow(535628) zinc finger protein 750
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024702 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024702 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024702 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044441 MISSION® esiRNA esiRNA human ZNF750 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024702 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244894 predicted 1954
2 SASI_Hs02_00357160 predicted 1637
3 SASI_Hs01_00244895 predicted 395
4 SASI_Hs01_00244896 predicted 1023
5 SASI_Hs01_00244897 predicted 1739
6 SASI_Hs01_00244898 predicted 502
7 SASI_Hs01_00244899 predicted 1430
8 SASI_Hs01_00244900 predicted 437
9 SASI_Hs01_00244902 predicted 1439
10 SASI_Hs01_00244903 predicted 1243
11 SASI_Hs01_00244901 predicted 434
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024702
ZNF750 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 750
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024702.2-370s21c1
Sequence:CCGGGAAAGCCCTTCAAGTATAAATCTCGAGATTTATACTTGAAGGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024702.2-3008s21c1
Sequence:CCGGATTACTGGTGAAGGTATTATCCTCGAGGATAATACCTTCACCAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024702.2-493s21c1
Sequence:CCGGGAGTTCCCAAGTGCCCTAAATCTCGAGATTTAGGGCACTTGGGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024702.2-1254s21c1
Sequence:CCGGCTGCCGATTCCTTACGGATTTCTCGAGAAATCCGTAAGGAATCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024702.2-1435s21c1
Sequence:CCGGTCGAGTTCGAAAGTCCAATTCCTCGAGGAATTGGACTTTCGAACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167853    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024702.1-2677s1c1
Sequence:CCGGGAATGACTCTAAGACTGATATCTCGAGATATCAGTCTTAGAGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024702.1-1223s1c1
Sequence:CCGGCTGCCGATTCCTTACGGATTTCTCGAGAAATCCGTAAGGAATCGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024702
ZNF750 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 750
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024702.2-370s21c1
Sequence:CCGGGAAAGCCCTTCAAGTATAAATCTCGAGATTTATACTTGAAGGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024702.2-3008s21c1
Sequence:CCGGATTACTGGTGAAGGTATTATCCTCGAGGATAATACCTTCACCAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024702.2-493s21c1
Sequence:CCGGGAGTTCCCAAGTGCCCTAAATCTCGAGATTTAGGGCACTTGGGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024702.2-1254s21c1
Sequence:CCGGCTGCCGATTCCTTACGGATTTCTCGAGAAATCCGTAAGGAATCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024702.2-1435s21c1
Sequence:CCGGTCGAGTTCGAAAGTCCAATTCCTCGAGGAATTGGACTTTCGAACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167853    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024702.1-2677s1c1
Sequence:CCGGGAATGACTCTAAGACTGATATCTCGAGATATCAGTCTTAGAGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024702.1-1223s1c1
Sequence:CCGGCTGCCGATTCCTTACGGATTTCTCGAGAAATCCGTAAGGAATCGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024702
ZNF750 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 750
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024702.2-370s21c1
Sequence:CCGGGAAAGCCCTTCAAGTATAAATCTCGAGATTTATACTTGAAGGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024702.2-3008s21c1
Sequence:CCGGATTACTGGTGAAGGTATTATCCTCGAGGATAATACCTTCACCAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024702.2-493s21c1
Sequence:CCGGGAGTTCCCAAGTGCCCTAAATCTCGAGATTTAGGGCACTTGGGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024702.2-1254s21c1
Sequence:CCGGCTGCCGATTCCTTACGGATTTCTCGAGAAATCCGTAAGGAATCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024702.2-1435s21c1
Sequence:CCGGTCGAGTTCGAAAGTCCAATTCCTCGAGGAATTGGACTTTCGAACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167853    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024702.1-2677s1c1
Sequence:CCGGGAATGACTCTAAGACTGATATCTCGAGATATCAGTCTTAGAGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024702.1-1223s1c1
Sequence:CCGGCTGCCGATTCCTTACGGATTTCTCGAGAAATCCGTAAGGAATCGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks