EMAIL THIS PAGE TO A FRIEND

ZNF75A

zinc finger protein 75a

UniProtKB ID: Q96N20, Q0VDI8, Q92669
Gene ID:
cow(100126179) zinc finger protein 75a
sheep(101122322) zinc finger protein 75a
domestic cat(101096196) zinc finger protein 75a
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153028 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153028 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153028 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120401 MISSION® esiRNA esiRNA human ZNF75A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153028 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153028 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135244 predicted 606
2 SASI_Hs01_00135245 predicted 1255
3 SASI_Hs01_00135246 predicted 1107
4 SASI_Hs01_00135247 predicted 928
5 SASI_Hs01_00135248 predicted 542
6 SASI_Hs01_00135249 predicted 1167
7 SASI_Hs01_00135250 predicted 942
8 SASI_Hs01_00135251 predicted 609
9 SASI_Hs01_00135252 predicted 1452
10 SASI_Hs02_00366985 predicted 1145
11 SASI_Hs01_00135243 predicted 733
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153028
ZNF75A MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 75a
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153028.1-597s1c1
Sequence:CCGGCCTAAAGTGATCTCCTGTCTACTCGAGTAGACAGGAGATCACTTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153028.1-1050s1c1
Sequence:CCGGCAACAGTGTGATAAGAGGTTTCTCGAGAAACCTCTTATCACACTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153028.1-656s1c1
Sequence:CCGGGTTTAAGGATAGTGCCGGAAACTCGAGTTTCCGGCACTATCCTTAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153028.1-1287s1c1
Sequence:CCGGCAGCCATATACTTGTAGCATACTCGAGTATGCTACAAGTATATGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153028.2-1735s21c1
Sequence:CCGGCAGTAGCAGGCTTACCAATTTCTCGAGAAATTGGTAAGCCTGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153028.2-1859s21c1
Sequence:CCGGTCACTTGAGTTCCTTCTTAAACTCGAGTTTAAGAAGGAACTCAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153028
ZNF75A MISSION shRNA shRNA Plasmid DNA
zinc finger protein 75a
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153028.1-597s1c1
Sequence:CCGGCCTAAAGTGATCTCCTGTCTACTCGAGTAGACAGGAGATCACTTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153028.1-1050s1c1
Sequence:CCGGCAACAGTGTGATAAGAGGTTTCTCGAGAAACCTCTTATCACACTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153028.1-656s1c1
Sequence:CCGGGTTTAAGGATAGTGCCGGAAACTCGAGTTTCCGGCACTATCCTTAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153028.1-1287s1c1
Sequence:CCGGCAGCCATATACTTGTAGCATACTCGAGTATGCTACAAGTATATGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153028.2-1735s21c1
Sequence:CCGGCAGTAGCAGGCTTACCAATTTCTCGAGAAATTGGTAAGCCTGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153028.2-1859s21c1
Sequence:CCGGTCACTTGAGTTCCTTCTTAAACTCGAGTTTAAGAAGGAACTCAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153028
ZNF75A MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 75a
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153028.1-597s1c1
Sequence:CCGGCCTAAAGTGATCTCCTGTCTACTCGAGTAGACAGGAGATCACTTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153028.1-1050s1c1
Sequence:CCGGCAACAGTGTGATAAGAGGTTTCTCGAGAAACCTCTTATCACACTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153028.1-656s1c1
Sequence:CCGGGTTTAAGGATAGTGCCGGAAACTCGAGTTTCCGGCACTATCCTTAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153028.1-1287s1c1
Sequence:CCGGCAGCCATATACTTGTAGCATACTCGAGTATGCTACAAGTATATGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153028.2-1735s21c1
Sequence:CCGGCAGTAGCAGGCTTACCAATTTCTCGAGAAATTGGTAAGCCTGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153028.2-1859s21c1
Sequence:CCGGTCACTTGAGTTCCTTCTTAAACTCGAGTTTAAGAAGGAACTCAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks