EMAIL THIS PAGE TO A FRIEND

ZNF75D

zinc finger protein 75D

Synonyms: D8C6 ZKSCAN24 ZNF75 ZNF82 ZSCAN28
UniProtKB ID: P51815, A6NK62, B3KRI7, Q5JPG0, Q6LDE0
Gene ID:
Human(7626) Summary: This gene encodes a protein that likely functions as a transcription factor. The protein, which belongs to the ZNF75 family, includes an N-terminal SCAN domain, a KRAB box, and five C2H2-type zinc finger motifs. Another functional gene belonging to this family is located on chromosome 16, while pseudogenes have been identified on chromosomes 11 and 12. Alternative splicing results in multiple transcripts variants. [provided by RefSeq, Jun 2010]
Horse(100063485) zinc finger protein 75D
dog(611850) zinc finger protein 75D
cow(614260) zinc finger protein 75D
sheep(101106826) zinc finger protein 75D
cow(100125581) zinc finger protein 75D
naked mole-rat(101701940) zinc finger protein 75D
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007131 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007131 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007131 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119231 MISSION® esiRNA esiRNA human ZNF75D (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007131 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007131 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100541 predicted 3461
2 SASI_Hs01_00100542 predicted 4075
3 SASI_Hs02_00343019 predicted 3170
4 SASI_Hs01_00100544 predicted 3395
5 SASI_Hs01_00100546 predicted 3933
6 SASI_Hs01_00100547 predicted 3906
7 SASI_Hs01_00100549 predicted 3409
8 SASI_Hs02_00343020 predicted 4082
9 SASI_Hs01_00100550 predicted 4089
10 SASI_Hs02_00343021 predicted 2711
11 SASI_Hs01_00100543 predicted 3615
12 SASI_Hs01_00100545 predicted 2854
13 SASI_Hs01_00100548 predicted 2754
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007131
ZNF75D MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 75D
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007131.2-3390s21c1
Sequence:CCGGTGAGGAAGAGTGGCAATTATTCTCGAGAATAATTGCCACTCTTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007131.2-3501s21c1
Sequence:CCGGTGGAAATGATCATCCTATATCCTCGAGGATATAGGATGATCATTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007131.2-3465s21c1
Sequence:CCGGTGTCATCTCTCTAGGGTTAAACTCGAGTTTAACCCTAGAGAGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007131.2-3891s21c1
Sequence:GTACCGGCATGACCCATCAAGGAATAAACTCGAGTTTATTCCTTGATGGGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007131.2-5078s21c1
Sequence:CCGGGATCAACTACAACCCTATATGCTCGAGCATATAGGGTTGTAGTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007131.2-5063s1c1
Sequence:CCGGCCCATCTTTATGGCTGATCAACTCGAGTTGATCAGCCATAAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007131.2-4088s1c1
Sequence:CCGGCGTGTAGCTTATGCAAGAGAACTCGAGTTCTCTTGCATAAGCTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007131.2-3679s1c1
Sequence:CCGGGCAACTTGTAAACAAGAGCTTCTCGAGAAGCTCTTGTTTACAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007131.2-3388s1c1
Sequence:CCGGTCTGAGGAAGAGTGGCAATTACTCGAGTAATTGCCACTCTTCCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007131.2-3218s1c1
Sequence:CCGGGCTGGAACACTCACAAAGAAACTCGAGTTTCTTTGTGAGTGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007131
ZNF75D MISSION shRNA shRNA Plasmid DNA
zinc finger protein 75D
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007131.2-3390s21c1
Sequence:CCGGTGAGGAAGAGTGGCAATTATTCTCGAGAATAATTGCCACTCTTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007131.2-3501s21c1
Sequence:CCGGTGGAAATGATCATCCTATATCCTCGAGGATATAGGATGATCATTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007131.2-3465s21c1
Sequence:CCGGTGTCATCTCTCTAGGGTTAAACTCGAGTTTAACCCTAGAGAGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007131.2-3891s21c1
Sequence:GTACCGGCATGACCCATCAAGGAATAAACTCGAGTTTATTCCTTGATGGGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007131.2-5078s21c1
Sequence:CCGGGATCAACTACAACCCTATATGCTCGAGCATATAGGGTTGTAGTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007131.2-5063s1c1
Sequence:CCGGCCCATCTTTATGGCTGATCAACTCGAGTTGATCAGCCATAAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007131.2-4088s1c1
Sequence:CCGGCGTGTAGCTTATGCAAGAGAACTCGAGTTCTCTTGCATAAGCTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007131.2-3679s1c1
Sequence:CCGGGCAACTTGTAAACAAGAGCTTCTCGAGAAGCTCTTGTTTACAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007131.2-3388s1c1
Sequence:CCGGTCTGAGGAAGAGTGGCAATTACTCGAGTAATTGCCACTCTTCCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007131.2-3218s1c1
Sequence:CCGGGCTGGAACACTCACAAAGAAACTCGAGTTTCTTTGTGAGTGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007131
ZNF75D MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 75D
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007131.2-3390s21c1
Sequence:CCGGTGAGGAAGAGTGGCAATTATTCTCGAGAATAATTGCCACTCTTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007131.2-3501s21c1
Sequence:CCGGTGGAAATGATCATCCTATATCCTCGAGGATATAGGATGATCATTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007131.2-3465s21c1
Sequence:CCGGTGTCATCTCTCTAGGGTTAAACTCGAGTTTAACCCTAGAGAGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007131.2-3891s21c1
Sequence:GTACCGGCATGACCCATCAAGGAATAAACTCGAGTTTATTCCTTGATGGGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007131.2-5078s21c1
Sequence:CCGGGATCAACTACAACCCTATATGCTCGAGCATATAGGGTTGTAGTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007131.2-5063s1c1
Sequence:CCGGCCCATCTTTATGGCTGATCAACTCGAGTTGATCAGCCATAAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007131.2-4088s1c1
Sequence:CCGGCGTGTAGCTTATGCAAGAGAACTCGAGTTCTCTTGCATAAGCTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007131.2-3679s1c1
Sequence:CCGGGCAACTTGTAAACAAGAGCTTCTCGAGAAGCTCTTGTTTACAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007131.2-3388s1c1
Sequence:CCGGTCTGAGGAAGAGTGGCAATTACTCGAGTAATTGCCACTCTTCCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007131.2-3218s1c1
Sequence:CCGGGCTGGAACACTCACAAAGAAACTCGAGTTTCTTTGTGAGTGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks