EMAIL THIS PAGE TO A FRIEND

ZNF761

zinc finger protein 761

Synonyms: ZNF468
UniProtKB ID: Q86XN6, Q6ZNB9
Gene ID:
Rat(499056) zinc finger protein 761
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008401 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008401 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008401 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008401 Rosetta Predictions human pricing
XM_574335 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008401 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305438 predicted 479
2 SASI_Hs02_00305439 predicted 941
3 SASI_Hs01_00103624 predicted 1837
4 SASI_Hs01_00103625 predicted 1854
5 SASI_Hs01_00103626 predicted 635
6 SASI_Hs02_00305440 predicted 2011
7 SASI_Hs02_00305441 predicted 475
8 SASI_Hs01_00103628 predicted 1662
9 SASI_Hs01_00103627 predicted 1600
10 SASI_Hs01_00103629 predicted 836
11 SASI_Hs01_00103630 predicted 191
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574335 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401783 predicted 579
2 SASI_Rn02_00401784 predicted 676
3 SASI_Rn02_00401785 predicted 930
4 SASI_Rn02_00401786 predicted 655
5 SASI_Rn02_00401787 predicted 667
6 SASI_Rn02_00401788 predicted 811
7 SASI_Rn02_00401789 predicted 932
8 SASI_Rn02_00401790 predicted 618
9 SASI_Rn02_00401791 predicted 427
10 SASI_Rn02_00401792 predicted 605
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008401
ZNF761 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 761
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008401.1-2619s1c1
Sequence:CCGGCCATTGTGAATCACTGGAGAACTCGAGTTCTCCAGTGATTCACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008401.1-1858s1c1
Sequence:CCGGCGTGTGAAATCAAACCTTGAACTCGAGTTCAAGGTTTGATTTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008401.1-2730s1c1
Sequence:CCGGGCTGGAGAGAAACCTTACAAACTCGAGTTTGTAAGGTTTCTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008401.1-2137s1c1
Sequence:CCGGCGTAGACTTCATACTGGAGAACTCGAGTTCTCCAGTATGAAGTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008401.1-1180s1c1
Sequence:CCGGGCTTACAGTTTCAGATCAAATCTCGAGATTTGATCTGAAACTGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008401.1-837s1c1
Sequence:CCGGCGACAAAGCTTTCCATTTCAACTCGAGTTGAAATGGAAAGCTTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008401.1-832s1c1
Sequence:CCGGGAATGCGACAAAGCTTTCCATCTCGAGATGGAAAGCTTTGTCGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008401
ZNF761 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 761
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008401.1-2619s1c1
Sequence:CCGGCCATTGTGAATCACTGGAGAACTCGAGTTCTCCAGTGATTCACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008401.1-1858s1c1
Sequence:CCGGCGTGTGAAATCAAACCTTGAACTCGAGTTCAAGGTTTGATTTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008401.1-2730s1c1
Sequence:CCGGGCTGGAGAGAAACCTTACAAACTCGAGTTTGTAAGGTTTCTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008401.1-2137s1c1
Sequence:CCGGCGTAGACTTCATACTGGAGAACTCGAGTTCTCCAGTATGAAGTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008401.1-1180s1c1
Sequence:CCGGGCTTACAGTTTCAGATCAAATCTCGAGATTTGATCTGAAACTGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008401.1-837s1c1
Sequence:CCGGCGACAAAGCTTTCCATTTCAACTCGAGTTGAAATGGAAAGCTTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008401.1-832s1c1
Sequence:CCGGGAATGCGACAAAGCTTTCCATCTCGAGATGGAAAGCTTTGTCGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008401
ZNF761 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 761
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008401.1-2619s1c1
Sequence:CCGGCCATTGTGAATCACTGGAGAACTCGAGTTCTCCAGTGATTCACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008401.1-1858s1c1
Sequence:CCGGCGTGTGAAATCAAACCTTGAACTCGAGTTCAAGGTTTGATTTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008401.1-2730s1c1
Sequence:CCGGGCTGGAGAGAAACCTTACAAACTCGAGTTTGTAAGGTTTCTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008401.1-2137s1c1
Sequence:CCGGCGTAGACTTCATACTGGAGAACTCGAGTTCTCCAGTATGAAGTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008401.1-1180s1c1
Sequence:CCGGGCTTACAGTTTCAGATCAAATCTCGAGATTTGATCTGAAACTGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008401.1-837s1c1
Sequence:CCGGCGACAAAGCTTTCCATTTCAACTCGAGTTGAAATGGAAAGCTTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008401.1-832s1c1
Sequence:CCGGGAATGCGACAAAGCTTTCCATCTCGAGATGGAAAGCTTTGTCGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks