EMAIL THIS PAGE TO A FRIEND

ZNF763

zinc finger protein 763

Synonyms: ZNF ZNF440L
Species: Human ZNF763(284390)
UniProtKB ID: Q0D2J5, B3KRU3
Gene ID:
34 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012753 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012753 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012753 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012753 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012753 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141862 predicted 353
2 SASI_Hs01_00141863 predicted 1037
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012753
ZNF763 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 763
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012753.1-1440s1c1
Sequence:CCGGGCCATGTGGTAAAGCCTTCAACTCGAGTTGAAGGCTTTACCACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012753.1-263s1c1
Sequence:CCGGGCTGGAAACTTTCAGGAACCTCTCGAGAGGTTCCTGAAAGTTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012753.1-224s1c1
Sequence:CCGGGCTGGATATTTCGCAGAGGAACTCGAGTTCCTCTGCGAAATATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012753.1-1733s1c1
Sequence:CCGGCCCACGTCATTTCAAAGACATCTCGAGATGTCTTTGAAATGACGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012753.1-954s1c1
Sequence:CCGGGCATTCCATAGTTCCAGTTCTCTCGAGAGAACTGGAACTATGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012753.1-786s1c1
Sequence:CCGGGCTGTCCATTGTCTCAGATTACTCGAGTAATCTGAGACAATGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012753.1-390s1c1
Sequence:CCGGGAAGACAGTCATTGTGGAGAACTCGAGTTCTCCACAATGACTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012753
ZNF763 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 763
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012753.1-1440s1c1
Sequence:CCGGGCCATGTGGTAAAGCCTTCAACTCGAGTTGAAGGCTTTACCACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012753.1-263s1c1
Sequence:CCGGGCTGGAAACTTTCAGGAACCTCTCGAGAGGTTCCTGAAAGTTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012753.1-224s1c1
Sequence:CCGGGCTGGATATTTCGCAGAGGAACTCGAGTTCCTCTGCGAAATATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012753.1-1733s1c1
Sequence:CCGGCCCACGTCATTTCAAAGACATCTCGAGATGTCTTTGAAATGACGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012753.1-954s1c1
Sequence:CCGGGCATTCCATAGTTCCAGTTCTCTCGAGAGAACTGGAACTATGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012753.1-786s1c1
Sequence:CCGGGCTGTCCATTGTCTCAGATTACTCGAGTAATCTGAGACAATGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012753.1-390s1c1
Sequence:CCGGGAAGACAGTCATTGTGGAGAACTCGAGTTCTCCACAATGACTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012753
ZNF763 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 763
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012753.1-1440s1c1
Sequence:CCGGGCCATGTGGTAAAGCCTTCAACTCGAGTTGAAGGCTTTACCACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012753.1-263s1c1
Sequence:CCGGGCTGGAAACTTTCAGGAACCTCTCGAGAGGTTCCTGAAAGTTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012753.1-224s1c1
Sequence:CCGGGCTGGATATTTCGCAGAGGAACTCGAGTTCCTCTGCGAAATATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012753.1-1733s1c1
Sequence:CCGGCCCACGTCATTTCAAAGACATCTCGAGATGTCTTTGAAATGACGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012753.1-954s1c1
Sequence:CCGGGCATTCCATAGTTCCAGTTCTCTCGAGAGAACTGGAACTATGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012753.1-786s1c1
Sequence:CCGGGCTGTCCATTGTCTCAGATTACTCGAGTAATCTGAGACAATGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012753.1-390s1c1
Sequence:CCGGGAAGACAGTCATTGTGGAGAACTCGAGTTCTCCACAATGACTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks