EMAIL THIS PAGE TO A FRIEND

ZNF764

zinc finger protein 764

UniProtKB ID: Q96H86, A8MZF4, B3KSN2, H9KV99, Q9BWS1
Gene ID:
dog(100683431) zinc finger protein 764
domestic cat(101085680) zinc finger protein 764
naked mole-rat(101725323) zinc finger protein 764
cow(100847190) zinc finger protein 764
sheep(101122752) zinc finger protein 764
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033410 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033410 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033410 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021681 MISSION® esiRNA esiRNA human ZNF764 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033410 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135062 predicted 357
2 SASI_Hs01_00135063 predicted 643
3 SASI_Hs01_00135064 predicted 370
4 SASI_Hs02_00361305 predicted 371
5 SASI_Hs01_00135065 predicted 1260
6 SASI_Hs01_00135066 predicted 847
7 SASI_Hs01_00135067 predicted 1328
8 SASI_Hs01_00135069 predicted 271
9 SASI_Hs01_00135070 predicted 279
10 SASI_Hs01_00135071 predicted 281
11 SASI_Hs01_00135068 predicted 1400
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033410
ZNF764 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 764
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033410.2-361s1c1
Sequence:CCGGGTGGCGAAATGTCAGACACAACTCGAGTTGTGTCTGACATTTCGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033410.2-1156s1c1
Sequence:CCGGGCCAAACACCAGTGGGTTCATCTCGAGATGAACCCACTGGTGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033410.2-387s1c1
Sequence:CCGGCCCAGCAGATTCCAGAAACAACTCGAGTTGTTTCTGGAATCTGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033410.2-663s1c1
Sequence:CCGGCTACAGTCACACTGGCGAGAACTCGAGTTCTCGCCAGTGTGACTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033410.2-270s1c1
Sequence:CCGGCGCTCTCGGAATCGGAGGCAACTCGAGTTGCCTCCGATTCCGAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033410.2-1665s21c1
Sequence:CCGGTGACCCTCCCAGAACACAATACTCGAGTATTGTGTTCTGGGAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033410.2-1142s21c1
Sequence:CCGGAGAAGTCAGCCGTGGCCAAACCTCGAGGTTTGGCCACGGCTGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033410.2-1434s21c1
Sequence:CCGGAGTCTGATCTTGGGCCCTTAGCTCGAGCTAAGGGCCCAAGATCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033410.2-287s21c1
Sequence:CCGGGCAACAAGCCAGCTCTCATCTCTCGAGAGATGAGAGCTGGCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033410.2-376s21c1
Sequence:CCGGACACAAACGGACCCAGCAGATCTCGAGATCTGCTGGGTCCGTTTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033410.2-1761s21c1
Sequence:CCGGTGGTGTGAACAGGGCTAACTGCTCGAGCAGTTAGCCCTGTTCACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033410.2-1283s21c1
Sequence:CCGGCGGAGATATTCCAGGAGTGTGCTCGAGCACACTCCTGGAATATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033410
ZNF764 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 764
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033410.2-361s1c1
Sequence:CCGGGTGGCGAAATGTCAGACACAACTCGAGTTGTGTCTGACATTTCGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033410.2-1156s1c1
Sequence:CCGGGCCAAACACCAGTGGGTTCATCTCGAGATGAACCCACTGGTGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033410.2-387s1c1
Sequence:CCGGCCCAGCAGATTCCAGAAACAACTCGAGTTGTTTCTGGAATCTGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033410.2-663s1c1
Sequence:CCGGCTACAGTCACACTGGCGAGAACTCGAGTTCTCGCCAGTGTGACTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033410.2-270s1c1
Sequence:CCGGCGCTCTCGGAATCGGAGGCAACTCGAGTTGCCTCCGATTCCGAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033410.2-1665s21c1
Sequence:CCGGTGACCCTCCCAGAACACAATACTCGAGTATTGTGTTCTGGGAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033410.2-1142s21c1
Sequence:CCGGAGAAGTCAGCCGTGGCCAAACCTCGAGGTTTGGCCACGGCTGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033410.2-1434s21c1
Sequence:CCGGAGTCTGATCTTGGGCCCTTAGCTCGAGCTAAGGGCCCAAGATCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033410.2-287s21c1
Sequence:CCGGGCAACAAGCCAGCTCTCATCTCTCGAGAGATGAGAGCTGGCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033410.2-376s21c1
Sequence:CCGGACACAAACGGACCCAGCAGATCTCGAGATCTGCTGGGTCCGTTTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033410.2-1761s21c1
Sequence:CCGGTGGTGTGAACAGGGCTAACTGCTCGAGCAGTTAGCCCTGTTCACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033410.2-1283s21c1
Sequence:CCGGCGGAGATATTCCAGGAGTGTGCTCGAGCACACTCCTGGAATATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033410
ZNF764 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 764
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033410.2-361s1c1
Sequence:CCGGGTGGCGAAATGTCAGACACAACTCGAGTTGTGTCTGACATTTCGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033410.2-1156s1c1
Sequence:CCGGGCCAAACACCAGTGGGTTCATCTCGAGATGAACCCACTGGTGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033410.2-387s1c1
Sequence:CCGGCCCAGCAGATTCCAGAAACAACTCGAGTTGTTTCTGGAATCTGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033410.2-663s1c1
Sequence:CCGGCTACAGTCACACTGGCGAGAACTCGAGTTCTCGCCAGTGTGACTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033410.2-270s1c1
Sequence:CCGGCGCTCTCGGAATCGGAGGCAACTCGAGTTGCCTCCGATTCCGAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033410.2-1665s21c1
Sequence:CCGGTGACCCTCCCAGAACACAATACTCGAGTATTGTGTTCTGGGAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033410.2-1142s21c1
Sequence:CCGGAGAAGTCAGCCGTGGCCAAACCTCGAGGTTTGGCCACGGCTGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033410.2-1434s21c1
Sequence:CCGGAGTCTGATCTTGGGCCCTTAGCTCGAGCTAAGGGCCCAAGATCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033410.2-287s21c1
Sequence:CCGGGCAACAAGCCAGCTCTCATCTCTCGAGAGATGAGAGCTGGCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033410.2-376s21c1
Sequence:CCGGACACAAACGGACCCAGCAGATCTCGAGATCTGCTGGGTCCGTTTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033410.2-1761s21c1
Sequence:CCGGTGGTGTGAACAGGGCTAACTGCTCGAGCAGTTAGCCCTGTTCACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033410.2-1283s21c1
Sequence:CCGGCGGAGATATTCCAGGAGTGTGCTCGAGCACACTCCTGGAATATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks