EMAIL THIS PAGE TO A FRIEND

ZNF765

zinc finger protein 765

Species: Human ZNF765(91661)
UniProtKB ID: Q7L2R6, A8MYG0, B4DF18, B7ZAI5, B9EIL1, Q9BV49
Gene ID:
29 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102953 Anti-ZNF765 (ab1) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2102954 Anti-ZNF765 (ab2) antibody produced in rabbit affinity isolated antibody rat, horse, bovine, human, mouse, canine, zebrafish, rabbit,
western blot pricing
SAB2106197 Anti-ZNF765, (N-terminal) antibody produced in rabbit affinity isolated antibody human, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138372 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138372 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138372 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040185 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180437 predicted 378
2 SASI_Hs01_00180438 predicted 1389
3 SASI_Hs01_00180439 predicted 1671
4 SASI_Hs02_00308894 predicted 1125
5 SASI_Hs01_00180440 predicted 1388
6 SASI_Hs01_00180441 predicted 1395
7 SASI_Hs01_00180442 predicted 1666
8 SASI_Hs01_00180443 predicted 1696
9 SASI_Hs01_00180444 predicted 970
10 SASI_Hs01_00180446 predicted 870
11 SASI_Hs01_00180445 predicted 391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138372
VALIDATED
ZNF765 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 765
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_138372.1-176s1c1
Sequence:CCGGGACTCTATACAGGGACGTGATCTCGAGATCACGTCCCTGTATAGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138372.1-197s1c1
Sequence:CCGGGCTGGAGAATTATAGGAACCTCTCGAGAGGTTCCTATAATTCTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_138372.1-115s1c1
Sequence:CCGGTCAGGGATGTGGCCATAGAATCTCGAGATTCTATGGCCACATCCCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_138372.1-164s1c1
Sequence:CCGGCCCTGCTCAGAGGACTCTATACTCGAGTATAGAGTCCTCTGAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_138372.1-189s1c1
Sequence:CCGGGACGTGATGCTGGAGAATTATCTCGAGATAATTCTCCAGCATCACGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138372
VALIDATED
ZNF765 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 765
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_138372.1-176s1c1
Sequence:CCGGGACTCTATACAGGGACGTGATCTCGAGATCACGTCCCTGTATAGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138372.1-197s1c1
Sequence:CCGGGCTGGAGAATTATAGGAACCTCTCGAGAGGTTCCTATAATTCTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_138372.1-115s1c1
Sequence:CCGGTCAGGGATGTGGCCATAGAATCTCGAGATTCTATGGCCACATCCCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_138372.1-164s1c1
Sequence:CCGGCCCTGCTCAGAGGACTCTATACTCGAGTATAGAGTCCTCTGAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_138372.1-189s1c1
Sequence:CCGGGACGTGATGCTGGAGAATTATCTCGAGATAATTCTCCAGCATCACGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138372
VALIDATED
ZNF765 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 765
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_138372.1-176s1c1
Sequence:CCGGGACTCTATACAGGGACGTGATCTCGAGATCACGTCCCTGTATAGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138372.1-197s1c1
Sequence:CCGGGCTGGAGAATTATAGGAACCTCTCGAGAGGTTCCTATAATTCTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_138372.1-115s1c1
Sequence:CCGGTCAGGGATGTGGCCATAGAATCTCGAGATTCTATGGCCACATCCCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_138372.1-164s1c1
Sequence:CCGGCCCTGCTCAGAGGACTCTATACTCGAGTATAGAGTCCTCTGAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_138372.1-189s1c1
Sequence:CCGGGACGTGATGCTGGAGAATTATCTCGAGATAATTCTCCAGCATCACGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks