EMAIL THIS PAGE TO A FRIEND

ZNF766

zinc finger protein 766

Species: Human ZNF766(90321)
UniProtKB ID: Q5HY98, B2RNE0, Q7Z326
Gene ID:
36 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010851 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010851 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010851 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146791 MISSION® esiRNA esiRNA human ZNF766 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010851 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010851 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305788 predicted 876
2 SASI_Hs01_00184106 predicted 1397
3 SASI_Hs01_00184107 predicted 462
4 SASI_Hs01_00184109 predicted 346
5 SASI_Hs01_00184110 predicted 279
6 SASI_Hs01_00184111 predicted 370
7 SASI_Hs01_00184112 predicted 1434
8 SASI_Hs01_00184113 predicted 823
9 SASI_Hs02_00305789 predicted 378
10 SASI_Hs02_00305790 predicted 956
11 SASI_Hs01_00184108 predicted 1427
12 SASI_Hs01_00184114 predicted 438
13 SASI_Hs01_00184115 predicted 259
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010851
VALIDATED
ZNF766 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 766
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010851.2-2065s1c1
Sequence:CCGGGCCTATAATCTCAGCACAATACTCGAGTATTGTGCTGAGATTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010851.2-957s1c1
Sequence:CCGGGCAAGGTTTATAGTAGCAGTTCTCGAGAACTGCTACTATAAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001010851.2-1214s1c1
Sequence:CCGGGTCTTCACTCAAGTTTCACATCTCGAGATGTGAAACTTGAGTGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010851.2-729s1c1
Sequence:CCGGGCCTCGCAGAACATTGGAGAACTCGAGTTCTCCAATGTTCTGCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010851.2-208s1c1
Sequence:CCGGGAGTATTATCTCCATGATGAACTCGAGTTCATCATGGAGATAATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010851
VALIDATED
ZNF766 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 766
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010851.2-2065s1c1
Sequence:CCGGGCCTATAATCTCAGCACAATACTCGAGTATTGTGCTGAGATTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010851.2-957s1c1
Sequence:CCGGGCAAGGTTTATAGTAGCAGTTCTCGAGAACTGCTACTATAAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001010851.2-1214s1c1
Sequence:CCGGGTCTTCACTCAAGTTTCACATCTCGAGATGTGAAACTTGAGTGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010851.2-729s1c1
Sequence:CCGGGCCTCGCAGAACATTGGAGAACTCGAGTTCTCCAATGTTCTGCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010851.2-208s1c1
Sequence:CCGGGAGTATTATCTCCATGATGAACTCGAGTTCATCATGGAGATAATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010851
VALIDATED
ZNF766 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 766
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010851.2-2065s1c1
Sequence:CCGGGCCTATAATCTCAGCACAATACTCGAGTATTGTGCTGAGATTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010851.2-957s1c1
Sequence:CCGGGCAAGGTTTATAGTAGCAGTTCTCGAGAACTGCTACTATAAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001010851.2-1214s1c1
Sequence:CCGGGTCTTCACTCAAGTTTCACATCTCGAGATGTGAAACTTGAGTGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010851.2-729s1c1
Sequence:CCGGGCCTCGCAGAACATTGGAGAACTCGAGTTCTCCAATGTTCTGCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010851.2-208s1c1
Sequence:CCGGGAGTATTATCTCCATGATGAACTCGAGTTCATCATGGAGATAATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks