EMAIL THIS PAGE TO A FRIEND

ZNF767

zinc finger family member 767

UniProtKB ID: Q75MW2, D3DWG6, Q86WY4, Q9H9J3
Gene ID:
chicken(420372) zinc finger family member 767
184 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024910 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024910 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024910 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU117801 MISSION® esiRNA esiRNA human ZNF767 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024910 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221803 predicted 757
2 SASI_Hs01_00221804 predicted 740
3 SASI_Hs01_00221805 predicted 755
4 SASI_Hs01_00221806 predicted 707
5 SASI_Hs01_00221807 predicted 1057
6 SASI_Hs01_00221808 predicted 1092
7 SASI_Hs01_00221809 predicted 1084
8 SASI_Hs01_00221810 predicted 1088
9 SASI_Hs02_00357519 predicted 763
10 SASI_Hs01_00221811 predicted 751
11 SASI_Hs01_00221802 predicted 1099
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024910
VALIDATED
ZNF767 MISSION shRNA Bacterial Glycerol Stock
zinc finger family member 767
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024910.1-519s1c1
Sequence:CCGGCAGATTGAACAAGGGAAGGAGCTCGAGCTCCTTCCCTTGTTCAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024910.1-482s1c1
Sequence:CCGGCTAAGACTACGCCATCTCCAACTCGAGTTGGAGATGGCGTAGTCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024910.1-685s1c1
Sequence:CCGGGCCTGCCTCTTGGAATAGAAACTCGAGTTTCTATTCCAAGAGGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024910.1-510s1c1
Sequence:CCGGGTCCTCTCCCAGATTGAACAACTCGAGTTGTTCAATCTGGGAGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024910.1-2742s1c1
Sequence:CCGGGCAGGAAGATTCCAGTATAATCTCGAGATTATACTGGAATCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024910.1-256s1c1
Sequence:CCGGCTGCTTTCCCTAGAAGGTCAACTCGAGTTGACCTTCTAGGGAAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024910.1-569s1c1
Sequence:CCGGGATTCCAGATGTTCCTGTGGACTCGAGTCCACAGGAACATCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024910.1-220s1c1
Sequence:CCGGGCCATGGAGAGGAAGATTGAACTCGAGTTCAATCTTCCTCTCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024910.1-518s1c1
Sequence:CCGGCCAGATTGAACAAGGGAAGGACTCGAGTCCTTCCCTTGTTCAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024910.1-220s21c1
Sequence:CCGGGCCATGGAGAGGAAGATTGAACTCGAGTTCAATCTTCCTCTCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024910.1-2742s21c1
Sequence:CCGGGCAGGAAGATTCCAGTATAATCTCGAGATTATACTGGAATCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024910.1-518s21c1
Sequence:CCGGCCAGATTGAACAAGGGAAGGACTCGAGTCCTTCCCTTGTTCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024910.1-569s21c1
Sequence:CCGGGATTCCAGATGTTCCTGTGGACTCGAGTCCACAGGAACATCTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024910
VALIDATED
ZNF767 MISSION shRNA shRNA Plasmid DNA
zinc finger family member 767
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024910.1-519s1c1
Sequence:CCGGCAGATTGAACAAGGGAAGGAGCTCGAGCTCCTTCCCTTGTTCAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024910.1-482s1c1
Sequence:CCGGCTAAGACTACGCCATCTCCAACTCGAGTTGGAGATGGCGTAGTCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024910.1-685s1c1
Sequence:CCGGGCCTGCCTCTTGGAATAGAAACTCGAGTTTCTATTCCAAGAGGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024910.1-510s1c1
Sequence:CCGGGTCCTCTCCCAGATTGAACAACTCGAGTTGTTCAATCTGGGAGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024910.1-2742s1c1
Sequence:CCGGGCAGGAAGATTCCAGTATAATCTCGAGATTATACTGGAATCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024910.1-256s1c1
Sequence:CCGGCTGCTTTCCCTAGAAGGTCAACTCGAGTTGACCTTCTAGGGAAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024910.1-569s1c1
Sequence:CCGGGATTCCAGATGTTCCTGTGGACTCGAGTCCACAGGAACATCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024910.1-220s1c1
Sequence:CCGGGCCATGGAGAGGAAGATTGAACTCGAGTTCAATCTTCCTCTCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024910.1-518s1c1
Sequence:CCGGCCAGATTGAACAAGGGAAGGACTCGAGTCCTTCCCTTGTTCAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024910.1-220s21c1
Sequence:CCGGGCCATGGAGAGGAAGATTGAACTCGAGTTCAATCTTCCTCTCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024910.1-2742s21c1
Sequence:CCGGGCAGGAAGATTCCAGTATAATCTCGAGATTATACTGGAATCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024910.1-518s21c1
Sequence:CCGGCCAGATTGAACAAGGGAAGGACTCGAGTCCTTCCCTTGTTCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024910.1-569s21c1
Sequence:CCGGGATTCCAGATGTTCCTGTGGACTCGAGTCCACAGGAACATCTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024910
VALIDATED
ZNF767 MISSION shRNA Lentiviral Transduction Particles
zinc finger family member 767
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024910.1-519s1c1
Sequence:CCGGCAGATTGAACAAGGGAAGGAGCTCGAGCTCCTTCCCTTGTTCAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024910.1-482s1c1
Sequence:CCGGCTAAGACTACGCCATCTCCAACTCGAGTTGGAGATGGCGTAGTCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024910.1-685s1c1
Sequence:CCGGGCCTGCCTCTTGGAATAGAAACTCGAGTTTCTATTCCAAGAGGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024910.1-510s1c1
Sequence:CCGGGTCCTCTCCCAGATTGAACAACTCGAGTTGTTCAATCTGGGAGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024910.1-2742s1c1
Sequence:CCGGGCAGGAAGATTCCAGTATAATCTCGAGATTATACTGGAATCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024910.1-256s1c1
Sequence:CCGGCTGCTTTCCCTAGAAGGTCAACTCGAGTTGACCTTCTAGGGAAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024910.1-569s1c1
Sequence:CCGGGATTCCAGATGTTCCTGTGGACTCGAGTCCACAGGAACATCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024910.1-220s1c1
Sequence:CCGGGCCATGGAGAGGAAGATTGAACTCGAGTTCAATCTTCCTCTCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024910.1-518s1c1
Sequence:CCGGCCAGATTGAACAAGGGAAGGACTCGAGTCCTTCCCTTGTTCAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024910.1-220s21c1
Sequence:CCGGGCCATGGAGAGGAAGATTGAACTCGAGTTCAATCTTCCTCTCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024910.1-2742s21c1
Sequence:CCGGGCAGGAAGATTCCAGTATAATCTCGAGATTATACTGGAATCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024910.1-518s21c1
Sequence:CCGGCCAGATTGAACAAGGGAAGGACTCGAGTCCTTCCCTTGTTCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024910.1-569s21c1
Sequence:CCGGGATTCCAGATGTTCCTGTGGACTCGAGTCCACAGGAACATCTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks