EMAIL THIS PAGE TO A FRIEND

ZNF768

zinc finger protein 768

UniProtKB ID: Q9H5H4, Q569L7, Q96CX4
Gene ID:
domestic cat(101093318) zinc finger protein 768
Horse(100147271) zinc finger protein 768
dog(489906) zinc finger protein 768
cow(100847165) zinc finger protein 768
sheep(101122492) zinc finger protein 768
naked mole-rat(101724940) zinc finger protein 768
domestic guinea pig(100729856) zinc finger protein 768
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024671 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024671 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024671 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU020771 MISSION® esiRNA esiRNA human ZNF768 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024671 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024671 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052958 predicted 1209
2 SASI_Hs01_00052961 predicted 851
3 SASI_Hs01_00052962 predicted 1860
4 SASI_Hs01_00052967 predicted 1841
5 SASI_Hs02_00357088 predicted 1922
6 SASI_Hs02_00357089 predicted 1302
7 SASI_Hs02_00357090 predicted 1700
8 SASI_Hs02_00357091 predicted 944
9 SASI_Hs01_00052964 predicted 623
10 SASI_Hs01_00052965 predicted 644
11 SASI_Hs01_00052959 predicted 500
12 SASI_Hs01_00052960 predicted 685
13 SASI_Hs01_00052963 predicted 948
14 SASI_Hs01_00052966 predicted 605
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024671
VALIDATED
ZNF768 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 768
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_024671.3-219s21c1
Sequence:CCGGGTGCAGAGTTCTGACGAAATGCTCGAGCATTTCGTCAGAACTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_024671.3-2162s21c1
Sequence:CCGGGTTGAGTCAGGAGCGGGTAAACTCGAGTTTACCCGCTCCTGACTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_024671.3-603s21c1
Sequence:CCGGGAATCTGAGAGCTCTAGATATCTCGAGATATCTAGAGCTCTCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_024671.3-857s21c1
Sequence:CCGGGCAGTTTGAGATGCTTCAGAACTCGAGTTCTGAAGCATCTCAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024671.3-655s21c1
Sequence:CCGGGCCCAGAATTTGAAGCTCAAACTCGAGTTTGAGCTTCAAATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024671.2-655s1c1
Sequence:CCGGGCCCAGAATTTGAAGCTCAAACTCGAGTTTGAGCTTCAAATTCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_024671.2-466s1c1
Sequence:CCGGGCCCTGAGTTTGCACCCAGAACTCGAGTTCTGGGTGCAAACTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024671.2-333s1c1
Sequence:CCGGGAGATACCATTTGGGCTTGAACTCGAGTTCAAGCCCAAATGGTATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024671.2-729s1c1
Sequence:CCGGCCTTTGAATATCTCCGTAGGACTCGAGTCCTACGGAGATATTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024671.2-857s1c1
Sequence:CCGGGCAGTTTGAGATGCTTCAGAACTCGAGTTCTGAAGCATCTCAAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024671
VALIDATED
ZNF768 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 768
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_024671.3-219s21c1
Sequence:CCGGGTGCAGAGTTCTGACGAAATGCTCGAGCATTTCGTCAGAACTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_024671.3-2162s21c1
Sequence:CCGGGTTGAGTCAGGAGCGGGTAAACTCGAGTTTACCCGCTCCTGACTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_024671.3-603s21c1
Sequence:CCGGGAATCTGAGAGCTCTAGATATCTCGAGATATCTAGAGCTCTCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_024671.3-857s21c1
Sequence:CCGGGCAGTTTGAGATGCTTCAGAACTCGAGTTCTGAAGCATCTCAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024671.3-655s21c1
Sequence:CCGGGCCCAGAATTTGAAGCTCAAACTCGAGTTTGAGCTTCAAATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024671.2-655s1c1
Sequence:CCGGGCCCAGAATTTGAAGCTCAAACTCGAGTTTGAGCTTCAAATTCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_024671.2-466s1c1
Sequence:CCGGGCCCTGAGTTTGCACCCAGAACTCGAGTTCTGGGTGCAAACTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024671.2-333s1c1
Sequence:CCGGGAGATACCATTTGGGCTTGAACTCGAGTTCAAGCCCAAATGGTATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024671.2-729s1c1
Sequence:CCGGCCTTTGAATATCTCCGTAGGACTCGAGTCCTACGGAGATATTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024671.2-857s1c1
Sequence:CCGGGCAGTTTGAGATGCTTCAGAACTCGAGTTCTGAAGCATCTCAAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024671
VALIDATED
ZNF768 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 768
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_024671.3-219s21c1
Sequence:CCGGGTGCAGAGTTCTGACGAAATGCTCGAGCATTTCGTCAGAACTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_024671.3-2162s21c1
Sequence:CCGGGTTGAGTCAGGAGCGGGTAAACTCGAGTTTACCCGCTCCTGACTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_024671.3-603s21c1
Sequence:CCGGGAATCTGAGAGCTCTAGATATCTCGAGATATCTAGAGCTCTCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_024671.3-857s21c1
Sequence:CCGGGCAGTTTGAGATGCTTCAGAACTCGAGTTCTGAAGCATCTCAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024671.3-655s21c1
Sequence:CCGGGCCCAGAATTTGAAGCTCAAACTCGAGTTTGAGCTTCAAATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024671.2-655s1c1
Sequence:CCGGGCCCAGAATTTGAAGCTCAAACTCGAGTTTGAGCTTCAAATTCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_024671.2-466s1c1
Sequence:CCGGGCCCTGAGTTTGCACCCAGAACTCGAGTTCTGGGTGCAAACTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024671.2-333s1c1
Sequence:CCGGGAGATACCATTTGGGCTTGAACTCGAGTTCAAGCCCAAATGGTATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024671.2-729s1c1
Sequence:CCGGCCTTTGAATATCTCCGTAGGACTCGAGTCCTACGGAGATATTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024671.2-857s1c1
Sequence:CCGGGCAGTTTGAGATGCTTCAGAACTCGAGTTCTGAAGCATCTCAAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks