EMAIL THIS PAGE TO A FRIEND

ZNF76

zinc finger protein 76

Synonyms: D6S229E ZNF523 Zfp523
UniProtKB ID: P36508, Q9BQB2
Gene ID:
naked mole-rat(101723339) zinc finger protein 76
domestic guinea pig(100725404) zinc finger protein 76
cow(100300346) zinc finger protein 76
sheep(101121721) zinc finger protein 76
chicken(772107) zinc finger protein 76
Horse(100629994) zinc finger protein 76
domestic cat(101097894) zinc finger protein 76
dog(481754) zinc finger protein 76
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003427 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003427 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003427 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090411 MISSION® esiRNA esiRNA human ZNF76 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003427 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175744 predicted 1178
2 SASI_Hs01_00175745 predicted 1651
3 SASI_Hs01_00175746 predicted 2003
4 SASI_Hs01_00175747 predicted 1827
5 SASI_Hs01_00175748 predicted 348
6 SASI_Hs01_00175749 predicted 724
7 SASI_Hs01_00175750 predicted 332
8 SASI_Hs02_00335638 predicted 1822
9 SASI_Hs01_00175751 predicted 1751
10 SASI_Hs02_00335639 predicted 2000
11 SASI_Hs01_00175752 predicted 1894
12 SASI_Hs01_00175753 predicted 904
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003427
VALIDATED
ZNF76 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 76
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003427.3-1731s1c1
Sequence:CCGGCTGAGGACTCAAGTGTAGCATCTCGAGATGCTACACTTGAGTCCTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003427.3-1417s1c1
Sequence:CCGGAGCTTACCTTTCGGAGGTGAACTCGAGTTCACCTCCGAAAGGTAAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003427.3-743s1c1
Sequence:CCGGCATCACTTAAAGGTGCATGAACTCGAGTTCATGCACCTTTAAGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003427.3-1186s1c1
Sequence:CCGGCGAGTACTCGAGCTTGTATAACTCGAGTTATACAAGCTCGAGTACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003427.3-1003s1c1
Sequence:CCGGCACCACATCTAACATCCGCAACTCGAGTTGCGGATGTTAGATGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003427.3-480s21c1
Sequence:CCGGATGGCTCCACTGCCTACATTCCTCGAGGAATGTAGGCAGTGGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003427.3-734s21c1
Sequence:CCGGACCACCGCTCATCACTTAAAGCTCGAGCTTTAAGTGATGAGCGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003427.3-2406s21c1
Sequence:CCGGCCTGACACCACAGTCAATTAACTCGAGTTAATTGACTGTGGTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003427.3-1692s21c1
Sequence:CCGGCGCAGCCCGTCACAATCATTACTCGAGTAATGATTGTGACGGGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003427.3-1092s21c1
Sequence:CCGGTCACCAGCGCCACCAACTATACTCGAGTATAGTTGGTGGCGCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003427
VALIDATED
ZNF76 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 76
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003427.3-1731s1c1
Sequence:CCGGCTGAGGACTCAAGTGTAGCATCTCGAGATGCTACACTTGAGTCCTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003427.3-1417s1c1
Sequence:CCGGAGCTTACCTTTCGGAGGTGAACTCGAGTTCACCTCCGAAAGGTAAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003427.3-743s1c1
Sequence:CCGGCATCACTTAAAGGTGCATGAACTCGAGTTCATGCACCTTTAAGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003427.3-1186s1c1
Sequence:CCGGCGAGTACTCGAGCTTGTATAACTCGAGTTATACAAGCTCGAGTACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003427.3-1003s1c1
Sequence:CCGGCACCACATCTAACATCCGCAACTCGAGTTGCGGATGTTAGATGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003427.3-480s21c1
Sequence:CCGGATGGCTCCACTGCCTACATTCCTCGAGGAATGTAGGCAGTGGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003427.3-734s21c1
Sequence:CCGGACCACCGCTCATCACTTAAAGCTCGAGCTTTAAGTGATGAGCGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003427.3-2406s21c1
Sequence:CCGGCCTGACACCACAGTCAATTAACTCGAGTTAATTGACTGTGGTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003427.3-1692s21c1
Sequence:CCGGCGCAGCCCGTCACAATCATTACTCGAGTAATGATTGTGACGGGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003427.3-1092s21c1
Sequence:CCGGTCACCAGCGCCACCAACTATACTCGAGTATAGTTGGTGGCGCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003427
VALIDATED
ZNF76 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 76
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003427.3-1731s1c1
Sequence:CCGGCTGAGGACTCAAGTGTAGCATCTCGAGATGCTACACTTGAGTCCTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003427.3-1417s1c1
Sequence:CCGGAGCTTACCTTTCGGAGGTGAACTCGAGTTCACCTCCGAAAGGTAAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003427.3-743s1c1
Sequence:CCGGCATCACTTAAAGGTGCATGAACTCGAGTTCATGCACCTTTAAGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003427.3-1186s1c1
Sequence:CCGGCGAGTACTCGAGCTTGTATAACTCGAGTTATACAAGCTCGAGTACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003427.3-1003s1c1
Sequence:CCGGCACCACATCTAACATCCGCAACTCGAGTTGCGGATGTTAGATGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003427.3-480s21c1
Sequence:CCGGATGGCTCCACTGCCTACATTCCTCGAGGAATGTAGGCAGTGGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003427.3-734s21c1
Sequence:CCGGACCACCGCTCATCACTTAAAGCTCGAGCTTTAAGTGATGAGCGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003427.3-2406s21c1
Sequence:CCGGCCTGACACCACAGTCAATTAACTCGAGTTAATTGACTGTGGTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003427.3-1692s21c1
Sequence:CCGGCGCAGCCCGTCACAATCATTACTCGAGTAATGATTGTGACGGGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003427.3-1092s21c1
Sequence:CCGGTCACCAGCGCCACCAACTATACTCGAGTATAGTTGGTGGCGCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks